We narrowed to 4,378 results for: crispr c plasmids
-
Plasmid#223116PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with MKRCKS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(MKRCKS)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/MKRCKS)=D1135M, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(MRKCRS)-P2A-EGFP (RAS2821)
Plasmid#223102PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with MRKCRS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(MRKCRS)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(MRKCRS)=D1135M, S1136R, G1218K, E1219C, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(LWRYEK)-P2A-EGFP (RAS2986)
Plasmid#223094PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with LWRYEK amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(LWRYEK)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(LWRYEK)=D1135L, S1136W, G1218R, E1219Y, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(MKRCMV)-P2A-EGFP (AHK162)
Plasmid#223075PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with MKRCMV amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(MKRCMV)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(MKRCMV)=D1135M, S1136K, G1218R, E1219C, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(MRRWMR)-P2A-EGFP (RAS2816)
Plasmid#223068PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with MRRWMR amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(MRRWMR)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(MRRWMR)=D1135M, S1136R, G1218R, E1219W, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEED-Moontag:HA
Plasmid#219648PurposePermits GoldenGate assembly (BsmBI) of donor plasmids to knock-in Moontag and HAtag using the SEED/Harvest methodDepositorInsertMoonTag:HA SEED Cassette
Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEED-EYFP:HA
Plasmid#219656PurposePermits GoldenGate assembly (BsmBI) of donor plasmids to knock-in EYFP and HA tag using the SEED/Harvest methodDepositorInsertEYFP:HA SEED Cassette
Available SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM070
Plasmid#216816PurposeAspergillus nidulans codon-adjusted mCardinal fluorescent protein, includes linker for C-terminal tagging.DepositorInsertmCardinal
TagsVinnyLinkerExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cGR2176
Plasmid#188258PurposePlasmid ensures constitutive expression of the C-terminal fragment of split GR2 (aa 239-267), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorInsertcGR2176
UseCRISPRExpressionMammalianAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cDHFR174
Plasmid#188256PurposePlasmid ensures constitutive expression of the C-terminal fragment of split DHFR (aa 1-173), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(TBK1)
Plasmid#109322PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human TBK1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(SOD1)
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-3-FT-ENGRAM
Plasmid#179158PurposepiggyBac plasmid for 3'-FT ENGRAM recorderDepositorInsertCsy4
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterminPAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PCi
Plasmid#214038PurposeBacterial expression plasmid for strep-tagged Pci from Haliangium ochraceumDepositorInsertPCi
TagsStrep-tag IIExpressionBacterialMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT
Plasmid#214041PurposeBacterial expression plasmid for SAVED-CHAT from Haliangium ochraceumDepositorInsertSAVED-CHAT
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase_PCi
Plasmid#214049PurposeBacterial expression plasmid for SAVED-CHAT, PCaspase, and PCi from Haliangium ochraceumDepositorInsertSAVED-CHAT-Pcaspase-PCi
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PCaspase
Plasmid#214034PurposeBacterial expression plasmid for strep-tagged PCaspase (Prokaryotic Caspase) from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PC-σ
Plasmid#214037PurposeBacterial expression plasmid for strep-tagged PC-σ from Haliangium ochraceumDepositorInsertPC-σ
TagsStrep-tag IIExpressionBacterialMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRINCE-SaCas9-1
Plasmid#250957PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part I : the expression of SaCas9-NES)DepositorInsertEF1α-SaCas9; NES; NpuN;
UseAAV and CRISPRExpressionMammalianPromoterEF1αAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA
Plasmid#216323PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA
Plasmid#216322PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-MONARCH 2.0_crEGFP
Plasmid#224793PurposeLPUtopia matching RMCE donor plasmid with MONARCH 2.0 circuit with crRNA targeting EGFP.DepositorInsertscrEGFP
Triplex stablier
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only