We narrowed to 13,532 results for: lic
-
Plasmid#244087PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244080PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244085PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K534TAG)-HA
Plasmid#239776PurposeExpresses rat NF186 with a TAG codon at position 534 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K571TAG)-HA
Plasmid#239777PurposeExpresses rat NF186 with a TAG codon at position 571 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K604TAG)-HA
Plasmid#239778PurposeExpresses rat NF186 with a TAG codon at position 604 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K680TAG)-HA
Plasmid#239779PurposeExpresses rat NF186 with a TAG codon at position 680 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K809TAG)-HA
Plasmid#239780PurposeExpresses rat NF186 with a TAG codon at position 809 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSCrhaB2_ApyOAHIDS
Plasmid#226246PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHI, and the methyltransferase ApySDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
ApyS
TagsHexa-HistidineExpressionBacterialAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only