We narrowed to 2,734 results for: KL

#110301

Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)

Chris Kok-Lung Chan

Tiwari et al Nat Commun. 2018 Feb 14;9(1):677. doi: 1

May 23, 2018

Academic Institutions and Nonprofits only

#224547

Blast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vector

Elphege Nora

Hansen et al Science. 2025 Nov 27:eadt4221. doi: 10.1

Dec. 1, 2025

Academic Institutions and Nonprofits only

#159655

Empty backbone for cloning gRNA sequences for DNA targeting. Contains an T2A linked H2B mCherry nuclear reporter.

Joseph Brzezinski

Kaufman et al Development. 2021 Jun 15;148(12). pii: 2

March 19, 2021

Academic Institutions and Nonprofits only

#111575

Expresses full length PARP1 in mammalian cells

Thomas Muir

Liszczak et al Nat Chem Biol. 2018 Jul 16. pii: 10.1038

July 18, 2018

Academic Institutions and Nonprofits only

#159654

Empty backbone for cloning gRNA sequences for DNA targeting. Contains an T2A linked H2B GFP nuclear reporter.

Joseph Brzezinski

Kaufman et al Development. 2021 Jun 15;148(12). pii: 2

March 19, 2021

Academic Institutions and Nonprofits only

#193622

HA-tag heavy chain hypervariable regions grafted into 15F11 scaffold (Zhao et al., 2019) + rabbit heavy chain constant regions + exogenous N-term signal peptide. For co-expression with pDL026.

Jennifer DeLuca

DeLuca et al Elife. 2021 Dec 31;10. pii: 72093. doi:

Dec. 21, 2022

Industry, Academic Institutions, and Nonprofits

#193623

HA-tag light chain hypervariable regions grafted into 15F11 scaffold (Zhao et al., 2019) + rabbit light chain constant regions + exogenous N-term signal peptide. For co-expression with pDL025.

Jennifer DeLuca

DeLuca et al Elife. 2021 Dec 31;10. pii: 72093. doi:

Dec. 21, 2022

Industry, Academic Institutions, and Nonprofits

#79144

All-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSC

Jizhong Zou

Stoehr et al JCI Insight. 2019 May 21;5. pii: 128496.

June 29, 2016

Academic Institutions and Nonprofits only

#200317

Expresses the PE5max system to engineer the SF3B1 K700E mutation. Co-expresses both a puromycin resistance gene and tagRFP for selection.

Lili Wang

Fernandez et al Cancer Res Commun. 2024 Aug 28. doi: 10.

Aug. 28, 2024

Academic Institutions and Nonprofits only

#33103

Kunliang Guan

Zhao et al Genes Dev. 2008 Jul 15. 22(14):1962-71.

Feb. 10, 2012

Academic Institutions and Nonprofits only