We narrowed to 8,862 results for: BLI;
-
Plasmid#230055PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 fused to halotag. Can be directly transfected into neurons or used to prepare AAV expressing GluA1-scFv-Halo.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsHaloTagExpressionMammalianMutationPromoterhuman synapsinAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLPS-hSox2-gfp
Plasmid#49390Purposemammalian expression of human Sox2 fused to EGFPDepositorInsertSox2 (SOX2 Human)
UseCre/Lox; Acceptor vectorTagsEGFPExpressionMammalianMutationTGA (stop) to CCA (Pro) at nt 1027 with respect t…PromoterCMVAvailable sinceNov. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Alpha-synuclein-E46K
Plasmid#181723PurposeGalactose inducible expression of Alpha-synuclein-E46KDepositorInsertAlpha-synuclein (SNCA Human)
UseTagsExpressionYeastMutationE46KPromoterAvailable sinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
DDX3X in pENTR
Plasmid#216572Purposegateway cloning donor vector containing DDX3XDepositorInsertDDX3X (DDX3X Human)
UseGateway entry plasmidTagsExpressionMutationPromoterAvailable sinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b G12C
Plasmid#83130PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), G12C mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationG12CPromoterAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-69: NPM1-mTagRFP-T
Plasmid#124608PurposeHomology arms and linker-mTagRFP-T sequence for C-terminus tagging of human NPM1DepositorInsertNPM1 Homology Arms with linker-mTagRFP-T (NPM1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceMay 13, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
His6-SUMO-pET28a-EfaCas1
Plasmid#112793PurposeTo express enterococcus faecalis Cas1 protein in E. coliDepositorInsertEfaCas1
UseTagsHis6-SUMOExpressionBacterialMutationPromoterAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC- VP64-dCas9-VP64-T2A- GFP(No LoxP sites)
Plasmid#66708Purposeexpresses VP64-dCas9-VP64, same plasmid as Addgene 59791 but with LoxP sites removedDepositorInsertS.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64ExpressionMutationD10A and H840APromoterhUbCAvailable sinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
huntingtin_FL_NbioCflag
Plasmid#194767PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsAvi-tag (biotin acceptor peptide) and Flag-tagExpressionMammalianMutationQ23 (polyQ repeat)PromoterCMV and P10Available sinceJuly 27, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Hs.NRAS G12V
Plasmid#83174PurposeGateway ORF Entry clone of human NRAS [NM_002524.4 ] with stop codon (for native or N-terminal fusions), G12V mutationDepositorInsertneuroblastoma RAS viral oncogene homolog (NRAS Human)
UseGateway entry cloneTagsExpressionMutationG12VPromoterAvailable sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
MS2_SC2_S_Delta
Plasmid#175950PurposeGeneration of MS2 Virus-Like Particles packaged with the sequence for the WHO Delta SARS-CoV-2 S gene (Amino Acid 319-869)DepositorInsertsUseTagsExpressionBacterialMutationDelta (Amino Acid 319-869)PromoterT7Available sinceOct. 18, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
Hs.KRAS4b Q61H
Plasmid#83140PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), Q61H mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationQ61HPromoterAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pGEX-4T1-14-3-3 gamma GST
Plasmid#13280DepositorInsert14-3-3 gamma (Ywhag Rat)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceOct. 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-mAtf4-HT-puro
Plasmid#101795PurposeLentiviral vector containing C-terminally Halo-tag tagged mouse ATF4DepositorInsertActivating transcription factor 4 (Atf4 Mouse)
UseLentiviralTagsHalo tagExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PE-SUMO CRYBB1
Plasmid#217675PurposeFor expression of SUMO tagged human beta B1 crystallinDepositorInsertCRYBB1 (CRYBB1 Human)
UseTags6XHis and Smt3ExpressionBacterialMutationPromoterT7Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PE-SUMO CRYAB
Plasmid#217670PurposeFor expression of SUMO tagged human alpha B crystallinDepositorInsertCRYAB (CRYAB Human)
UseTags6XHis and Smt3ExpressionBacterialMutationPromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-His-APEX2
Plasmid#201471PurposeRecombinant soluble APEX2 for SLAPSHOT labelingDepositorInsertAPEX2
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTPN11 in pENTR
Plasmid#216604Purposegateway cloning donor vector containing PTPN11DepositorInsertPTPN11 (PTPN11 Human)
UseGateway entry plasmidTagsExpressionMutationPromoterAvailable sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TREtight-mTagBFP2-N2cG
Plasmid#192838Purposeplasmid for making helper virus for monosynaptic tracing using CVS-N2c rabies virus; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTADepositorInsertmTagBFP2 and rabies virus CVS-N2c strain glycoprotein genes (N2cG)
UseAAVTagsExpressionMammalianMutationPromoterTREtightAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b G12V
Plasmid#83132PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), G12V mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationG12VPromoterAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
p5'Entry-lck-5.5kb
Plasmid#58890Purposeprovides zebrafish lck promoter (5.5 kb) for GateWay construction of Tol2 transgenesDepositorInsertzebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 5.5 kb
UseGateway 5' entry cloneTagsExpressionMutationmutated single nucleotide (T-->C, 13th nucleot…Promoterlymphocyte-specific protein tyrosine kinase (lck)…Available sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationPromoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnd3
Plasmid#159912PurposeMutagenesis of Kcnd3DepositorInsertKcnd3 (Kcnd3 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE-T2-IRES-His6-Ubiquitin
Plasmid#107107PurposeDesigned to co-express target gene upstream of the IRES element at the multiple cloning site with downstream His6-tagged ubiquitin expressed after IRES.DepositorInserthuman ubiquitin UBB (UBB Human)
UseTags6xHisExpressionMammalianMutationPromoterTetAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAD_IPF2.0
Plasmid#163124PurposeA plasmid with IFP2.0 coding sequence coded into it. Expresses IFP2.0 with N-term His-tag.DepositorInsertIFP2.0
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
psd44-G13QL
Plasmid#46828Purposeexpression of mutant G protein alpha 13 in mammalian cellsDepositorInsertGNA13 (GNA13 Human)
UseLentiviralTagsExpressionMammalianMutationQ226L (The mutation reduces GTPase activity resul…PromoterPGK promoterAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9
Plasmid#153011PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + ACE2 gRNA (ACE2 Human)
UseCRISPR and LentiviralTagsTagBFP2ExpressionMutationPromoterAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Alpha-synuclein-H50Q
Plasmid#181724PurposeGalactose inducible expression of Alpha-synuclein-H50QDepositorInsertAlpha-synuclein (SNCA Human)
UseTagsExpressionYeastMutationH50QPromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC2735 (pSpy0C2)
Plasmid#220279Purposeintegrative plasmid for heterologous gene expression in S. pyogenes SF370, integrates into the amyA locus via homologous recombinationDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-eGFP-F
Plasmid#71545PurposeExpresses a membrane bound eGFP, under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV or β-actin-CMV promoters.DepositorInserteGFP-F
UseAAVTagscontains 20- amino-acid farnesylation signal from…ExpressionMammalianMutationPromoterUbCAvailable sinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
CD44Z-c011
Plasmid#175455PurposeProtein expression/secretion in mammalian cells. CD44s (standard form; exons 2-5, 15-16), A20-E649.DepositorInsertCD44 (CD44 Human)
UseTagsHis6ExpressionMammalianMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pScDD2_ERdd
Plasmid#109047Purposedestabilizing domains for yeast (S. cerevisiae) derived from the human estrogen receptor ligand binding domain. This ERdd can be stabilized with 10 uM 4-hydroxytamoxifen (4-OHT, OHTAM).DepositorInsertER50 (ESR1 H. sapiens gene with yeast enhanced codon)
UseTagsyeast enhanced GFP with 8 amino acids TSGRGEGQ li…ExpressionYeastMutation3 mutations : E380G, R434G, N532SPromoterSOD1Available sinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
Plasmid#105715PurposeIn the presence of Cre, the plasmid can be used to express GCaMP6s fused to the presynaptic protein synaptophysin. Drives enriched expression of GCaMP6s in neuronal axon boutons.DepositorHas ServiceAAV5Insertsynaptophysin-GCaMP6s
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterEf1a, Human elongation factor-1 alphaAvailable sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-BPNLS(SV40)-3xFLAG-P2A-mScarlet (MNW001)
Plasmid#174091PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a C-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationPromoterpCMV and T7Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shKGA
Plasmid#110420PurposeshKGA, silence glutaminase KGA isoform, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA Pol III)Available sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
saposin B^W
Plasmid#161759PurposeSaposin B (Homo Sapien) containing a single mutation, arginine 38 to tryptophanDepositorInsertsaposin B R38_W
UseTagsHis-tagExpressionBacterialMutationchanged Arginine 38 to TryptophanPromoterT7Available sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Kras G12V-T35S
Plasmid#58900PurposeExpresses human Kras with G12V and T35S mutationsDepositorInsertKRAS (KRAS Human)
UseRetroviralTagsHAExpressionMammalianMutationG12V and T35S mutations (effector binding mutant)PromoterAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b S17N
Plasmid#83156PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), S17N mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationS17NPromoterAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b G12R
Plasmid#83143PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), G12R mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationG12RPromoterAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
p413TEF1-ATR1(pYL573)
Plasmid#178288PurposeExpresses NADPH-cytochrome P450 reductase 1 from A. thaliana (ATR1) in Saccharomyces cerevisiae. Centromeric HIS, PTEF1-ATR1-TCYC1DepositorInsertATR1
UseTagsExpressionYeastMutationPromoterTEF1Available sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-p300-Hygro
Plasmid#104411Purposetransient expression of dCas9-p300 fusion proteinDepositorInsertp300 (EP300 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
DOT1L
Plasmid#36196PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertDOT1L (GeneScript Synthesized) (DOT1L Human)
UseTagsHis tag with TEV cleavageExpressionBacterialMutationcontains amino acid residues 1-420PromoterAvailable sinceAug. 8, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pAG426-GAL-Alpha-synuclein-A53T
Plasmid#181722PurposeGalactose inducible expression of Alpha-synuclein-A53TDepositorInsertAlpha-synuclein (SNCA Human)
UseTagsExpressionYeastMutationA53TPromoterAvailable sinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CasRX_Pac
Plasmid#194803PurposeCasRX vector for gene knockdown in Giardia. Insert gRNA using Bbs1 restriction site. Puromycin resistance cassette.DepositorInsertCasRX
UseTagsExpressionMutationPromoterAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-SUMO-sfGFP-WT
Plasmid#212122PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertsSUMO-sfGFP-WT
M. alvus Pyl-tRNA(6)
UseTagsHis6 and SUMOExpressionBacterialMutationPromoteraraC and lppAvailable sinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b Q61L
Plasmid#83134PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), Q61L mutationDepositorInsertKRAS (KRAS Human)
UseGateway entry cloneTagsExpressionMutationQ61LPromoterAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only