We narrowed to 18,091 results for: multi
-
Plasmid#127775PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Sox10 in frame with a Flag-tag and Avi-tagDepositorAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pMuLE ENTR CMV loxP L5-L2
Plasmid#62094PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site flanked by loxP sites. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCre/Lox; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-Lag16-fibcon-iCAM1-tether
Plasmid#205213PurposeThis vector encodes of the synCAM tether (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 Tether and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-AVI-Tfap2B-tev-FLAG-2A-Citrine
Plasmid#127776PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Tfap2B in frame with an Avi tag at the N terminus and FLAG-tag and Citrine at the C-terminusDepositorAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq-Tat (c-plasmid)
Plasmid#127635PurposeEncodes a fluorecent protein with an RNA binding peptide: mTurquoise2-tat.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme PlmJ and RBS BBa_B0034.DepositorInsertmTurquoise2
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_1.2μ-pcDNA3
Plasmid#111922PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_1.2μDepositorInsertCeNL(Ca2+)_1.2μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
ExpressionBacterialPromoterPosmY, PsulA, and grpEAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3- SREBP-1
Plasmid#204192PurposeMammalian expression of SREBP-1 (isoform 1)DepositorInsertSREBP-1 (SREBF1 Human)
TagsE-tag and T7x2ExpressionMammalianMutationmultiple silent mutationsAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1
Plasmid#138417PurposeCAPTURE1.1 vector containing BirA-V5-His, P2A, FB-dCas9, IRES and zsGreen1DepositorInsertsBirA
dCas9
UseLentiviralTagsFLAG, Avi-tag and V5, HisPromoterEF1aAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL1425 (pSPIN, pCDF backbone)
Plasmid#160735PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA and has BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-nosT
Plasmid#71272PurposeEntry clone containing nosT. Necessary to complete the transcriptional reporters by providing the poly-A tail. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertnopaline synthase terminator
UseGatewayAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Dre
Plasmid#55633PurposeExpresses Dre in Mammalian CellsDepositorInsertsmCherry
Dre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only