We narrowed to 1,691 results for: CAG promoter

#221827

Plasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only

#251688

gRNA to knock out SLC25A39 in mammalian cells

Boyi Gan

Lei et al Cancer Cell. 2025 Jun 9;43(6):1076-1092.

Feb. 3, 2026

Academic Institutions and Nonprofits only

#101659

Expresses AT1R with HA tag and YFP in mammalian cells.

Yusuke Ohba

Inuzuka et al Sci Rep. 2016 Feb 9;6:21613. doi: 10.103

Dec. 5, 2017

Academic Institutions and Nonprofits only

#159754

AAVS1 donor plasmid for targeted inducible eGFP expression in human cells

Xiaoping Bao

Chang et al Biomaterials. 2022 May 6;285:121569. doi

July 19, 2024

Academic Institutions and Nonprofits only

#101660

Expresses AT2R with FLAG tag and CFP in mammalian cells.

Yusuke Ohba

Inuzuka et al Sci Rep. 2016 Feb 9;6:21613. doi: 10.103

Dec. 5, 2017

Academic Institutions and Nonprofits only

#36881

Liqun Luo

Tasic et al PLoS One. 2012;7(3):e33332. Epub 2012 Ma

Aug. 30, 2012

Academic Institutions and Nonprofits only

#204344

Knock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.

Ivo Lieberam

Harley et al Cell Rep. 2023 Dec 26;42(12):113509. doi

Sept. 13, 2023

Academic Institutions and Nonprofits only

#220568

To inducibly knockdown CALM1 expression

Sean Lee

July 3, 2024

Academic Institutions and Nonprofits only

#40975

Joseph Loturco

Chen et al J Neurosci Methods. 2012 Jun 15;207(2):1

May 1, 2017

Academic Institutions and Nonprofits only

#104818

CRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.

Robert Stupar

Curtin et al Plant Biotechnol J. 2017 Oct 31. doi: 10

Feb. 7, 2018

Academic Institutions and Nonprofits only