We narrowed to 5,122 results for: NOG
-
Plasmid#112688Purposeexpress gRNA targeting Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.25 EC10-Fc-His
Plasmid#72188PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.25 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.25
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.25 EC10-AP-His
Plasmid#72062PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.25 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertDscam1_7.27.25
TagsAP-HisExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
KHBD00664
Plasmid#39719DepositorAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
10XUAS IVS Jaws mCherry_tr
Plasmid#111550PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mCherryDepositorInsertJaws_mCherry_trafficked
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHBD00675
Plasmid#39723DepositorAvailable SinceAug. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmMextli
Plasmid#79262PurposeExpresses EGFP-tagged DmMextli in S2 cellsDepositorInsertDmMextli (mxt NM_164598, Fly)
UseSchneider 2 cell expressionTagsEGFPPromoterAc5 promoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL
Plasmid#113012PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral WTDepositorInsertfull length tral (tral Fly)
ExpressionBacterialAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
RGD-ACP-I27-CC
Plasmid#85391PurposeMTFM sensor to measure integrin mechanical forces. Integrin binding domain fused to titan immunoglobulin domain (I27) with two cysteines (CC) for immobilization and ACP tag for fluorophore labelingDepositorInsertRGD motif for integrin binding fused to acyl carrier protein (ACP) tag and titin immunoglobulin domain (I27)
Tags6x HisExpressionBacterialPromoterT7Available SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
KHBD00652
Plasmid#39713DepositorAvailable SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBacPak-HA-Non-stop
Plasmid#52289PurposeExpresses Drosophila Non-stopDepositorAvailable SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
20XUAS IVS Jaws mVenus_tr
Plasmid#111552PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mVenusDepositorInsertJaws_mVenus_tr
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHBD00750
Plasmid#39756DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
KHBD00591
Plasmid#39673DepositorAvailable SinceAug. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00713
Plasmid#39742DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
Alt AlphaPS3
Plasmid#14070DepositorInsertDrosphila Alt Alpha PS3 Integrin (scb Fly)
ExpressionBacterialAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
KHBD00544
Plasmid#39639DepositorAvailable SinceAug. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00459
Plasmid#39572DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
KHBD00734
Plasmid#39750DepositorAvailable SinceSept. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only