We narrowed to 46,632 results for: cha;
-
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-nCLC
Plasmid#193564PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
nCLC-ShadowY
Plasmid#193565PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with ShadowY in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsShadowYExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-CLC
Plasmid#193567PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-FKBP-EGFP
Plasmid#193572PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLC-SNAP
Plasmid#193580PurposeExpresses human Clathrin Light Chain B tagged with SNAP-tag and mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsSNAP-tag and mEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ShadowY-CLC
Plasmid#193552PurposeExpresses mouse Clathrin Light Chain A tagged with mEGFP and ShadowY in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLCdeltaN
Plasmid#193562PurposeExpresses human Clathrin Light Chain B truncation mutant (deleted 1-89 aa) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 1-89PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-ELP-ddFLN4-XMod-Doc-HIS (wild type)
Plasmid#153439PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 fingerprint domain. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, ddFLN4 fingerprint domain, a…ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S631A
Plasmid#53058PurposeExpresses alpha subunit of S631A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 631 to AlaninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only