We narrowed to 4,079 results for: Gaa
-
Plasmid#215211PurposeSupression of shNUDC_2 expressionDepositorInsertNUDC shRNA 2 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_NUDC_1
Plasmid#215212PurposeSupression of shNUDC_1 expressionDepositorInsertNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24D
Plasmid#231565PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24D (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Snrnp48_i4-ipUSEPR-TR657
Plasmid#228926PurposeKnockdown of Snrnp48 in mammalian cellDepositorInsertsg_Snrnp48_i4 (Snrnp48 Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm1
Plasmid#222911PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 1 (NPM2 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm3
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 3 (NPM2 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-1
Plasmid#180400PurposeProducing AAV that encodes mouse Srpk3 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-3
Plasmid#180402PurposeProducing AAV that encodes mouse Srpk3 shRNA-3 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
hU6-sgNT2 (opti)
Plasmid#177238PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses non-targeting gRNADepositorInsertsgNT2
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hU6-sgNT3 (opti)
Plasmid#177239PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses non-targeting gRNADepositorInsertsgNT3
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpd_v1 (opti)
Plasmid#177249PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_COX4
Plasmid#177983Purposelentiviral vector expressing Cas9 and a sgRNA targeting COX4DepositorInsertsgRNA targeting COX4
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh1 gRNA#1
Plasmid#163394PurposeCas9-mediated knockout of Ssh1 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only