We narrowed to 3,170 results for: GRI
-
Plasmid#14071DepositorInsertDrosphila Comp Alpha PS3 Integrin (scb Fly)
ExpressionBacterialAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
mouse b8 full length
Plasmid#217817PurposeFull length mouse integrin b8 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse a5 full length
Plasmid#217810PurposeFull length mouse integrin a5 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b6 full length
Plasmid#217816PurposeFull length mouse integrin b6 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b3 full length
Plasmid#217814PurposeFull length mouse integrin b3 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV302
Plasmid#119943PurposeExpresses N-terminal Npu DnaE Intein-SaKKH-BE3 in mammalian cellsDepositorInsertN-terminal SaKKH-BE3(739) - N-Intein (Npu DnaE)
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human alpha5 ecto
Plasmid#221394PurposeMammalian expression of human integrin alpha5 ectodomainDepositorInsertintegrin alpha5 ectodomain (ITGA5 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HR…ExpressionMammalianMutationcodon optimized for human mature residues _5 F1 t…Available SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 Q280* full-length
Plasmid#221402PurposeMammalian expression of human integrin beta1 Q280* full-lengthDepositorInsertintegrin beta1 Q280* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 K418* full-length
Plasmid#221403PurposeMammalian expression of human integrin beta1 K418* full-lengthDepositorInsertintegrin beta1 K418* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* full-length
Plasmid#221404PurposeMammalian expression of human integrin beta1 N391* full-lengthDepositorInsertintegrin beta1 N391* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N562* full-length
Plasmid#221405PurposeMammalian expression of human integrin beta1 N562* full-lengthDepositorInsertintegrin beta1 N562* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
mouse b5 full length
Plasmid#217815PurposeFull length mouse integrin b5 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse av full length
Plasmid#217809PurposeFull length mouse integrin av expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 ecto
Plasmid#221398PurposeMammalian expression of human integrin beta1 ectodomainDepositorInsertintegrin beta1 ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only