We narrowed to 1,691 results for: CAG promoter

#100711

B52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)

Alberto Ciccia

Billon et al Mol Cell. 2017 Sep 4. pii: S1097-2765(17

Sept. 19, 2017

Academic Institutions and Nonprofits only

#100714

B52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)

Alberto Ciccia

Billon et al Mol Cell. 2017 Sep 4. pii: S1097-2765(17

Sept. 19, 2017

Academic Institutions and Nonprofits only

#186987

AAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guide

Omar Abudayyeh, Jonathan Gootenberg

Kato et al Cell. 2022 May 25. pii: S0092-8674(22)00

Sept. 6, 2022

Academic Institutions and Nonprofits only

#161763

pTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)

Shaun Curtin

Miller et al G3 (Bethesda). 2022 May 30;12(6). pii: 6

May 22, 2023

Academic Institutions and Nonprofits only

#161762

pTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)

Shaun Curtin

Miller et al G3 (Bethesda). 2022 May 30;12(6). pii: 6

May 22, 2023

Academic Institutions and Nonprofits only

#186985

AAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guide

Omar Abudayyeh, Jonathan Gootenberg

Kato et al Cell. 2022 May 25. pii: S0092-8674(22)00

Sept. 6, 2022

Academic Institutions and Nonprofits only

#13765

Connie Cepko

Matsuda et al Proc Natl Acad Sci U S A. 2007 Jan 16;10

April 20, 2007

Academic Institutions and Nonprofits only

#248694

sgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNA

Larry Halverson

Roghair Stroud et al ACS Synth Biol. 2024 Aug 20. doi: 10.102

Jan. 28, 2026

Academic Institutions and Nonprofits only

#221825

Plasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only

#221826

Plasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only