We narrowed to 6,180 results for: cas9 expression plasmid
-
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJAT7
Plasmid#204292PurposeFor inserting a phiC31 attP site. HDR integrant is marked with removable 3XP3-DsRed cassette, which is expressed in eyes. DsRed difficult to see in wild type eyes if using LeicaM165 FC microscope.DepositorInsert3XP3-DsRed
UseCRISPRPromoter3XP3Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-GFPd2
Plasmid#115665PurposePiggybac transposon plasmid for destabilized eGFP (GFPd2)DepositorInsertGFPd2
UseSynthetic BiologyTagsDestabilizationExpressionMammalianPromoterCAGAvailable SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-P2A-mScarlet (MNW002)
Plasmid#174137PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R); C-terminal bi-partite NLS, 3x flag tag, P2A-mScarletDepositorInserthuman codon optimized SpRY with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpG=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317…PromoterCMV and T7Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-FeGFP
Plasmid#138261PurposeDonor-eGFP vector to be used in plasmid to plasmid integration reporter assay. eGFP is conditionally expressed when integrated at iCas9-sites on acceptor plasmidDepositorInserteGFP
UseCRISPRExpressionMammalianPromoterNoneAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only