We narrowed to 7,295 results for: alp
-
Plasmid#23540DepositorInsertRPS6KA6 (RPS6KA6 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_WT
Plasmid#82150PurposeGateway Donor vector containing NRAS , part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAPK14_WT
Plasmid#82298PurposeGateway Donor vector containing MAPK14, part of the Target Accelerator Plasmid Collection.DepositorInsertMAPK14 (MAPK14 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
R713-M52-303: CMV51p> Halotag-NRasHVR
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorInsertHalotag-NRasHVR (NRAS Human)
UseTagsHalotagExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag CSNK1A1L
Plasmid#20467DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/10R]
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
UseTags10xHis, c-myc, and hTPA leaderExpressionMammalianMutationPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA1
Plasmid#23471DepositorInsertPHKA1 (PHKA1 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK1A1L
Plasmid#23784DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterUbcAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12V D38APromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterPGKAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA-plus exon 18a - Short-Cterm - Arginine -in pcDNA3
Plasmid#198915PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a, Short form of alternatively spliced C-teminus, SNP rs2278973 variant Arginine, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
UseTagsN-terminal GFP, internal double HAExpressionMammalianMutationsnp rs2278973 ArgininePromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NRAS(G12D)-Neo
Plasmid#232953PurposeExpresses mutant form of NRASDepositorInsertNRAS(G12D)-Neo (NRAS Human)
UseLentiviralTagsExpressionMutationG12DPromoterAvailable sinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:FRS2_CE_pISceI
Plasmid#223040PurposeExpress FRS2 gene in mesenchymal lineage of Zebrafish.DepositorInsertFRS2 (FRS2 Human)
UseExpress the insert(gene) in mesenchymal lineage o…TagsExpressionMutationPromoterRag2Available sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:CYP27B1_CE_pISceI
Plasmid#223028PurposeExpress CYP27B1 gene in mesenchymal lineage of Zebrafish.DepositorInsertCYP27B1 (CYP27B1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…TagsExpressionMutationPromoterRag2Available sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
Plasmid#229689PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPExpressionMutationPromoterLTR viral promoterAvailable sinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorInsertsgPRKAA2 (PRKAA2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorInsertDERA (DERA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
SHIP2-C1
Plasmid#214905Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domain and C-terminal sterile alpha motifDepositorInserthuman SHIP2 aa 740-1258 (INPPL1 Human)
UseTagsV5/HisExpressionMammalianMutationdelta 1-739aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pcDNA3
Plasmid#206093PurposeCav2.2 calcium channel with a N-terminal GFP tag, exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsGFPExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMVAvailable sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pCAGGS
Plasmid#206098Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMV/B-actinAvailable sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorInsertBrevican (Rattus norvegicus) recombinant scFV (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FAS-COMP5AP-AviTag-9xHis
Plasmid#157106PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFAS (FAS Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IL1R1-COMP5AP-AviTag-9xHis
Plasmid#157320PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertIL1R1 (IL1R1 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FASLG-COMP5AP-AviTag-9xHis
Plasmid#157143PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFASLG (FASLG Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-COMP5AP-AviTag-9xHis
Plasmid#157118PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertCD8A (CD8A Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-VSIR-COMP5AP-AviTag-9xHis
Plasmid#157120PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertVSIR (C10orf54 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CTLA4-COMP5AP-AviTag-9xHis
Plasmid#157074PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertCTLA4 (CTLA4 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCAR-Fc(DAPA)-AviTag-6xHis
Plasmid#156619PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCAR (FCAR Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ULBP2-Fc(DAPA)-AviTag-6xHis
Plasmid#156596PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertULBP2 (ULBP2 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-Fc(DAPA)-AviTag-6xHis
Plasmid#156553PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD8A (CD8A Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-719 CTLA4-GFP R70W
Plasmid#186124PurposeCTLA4 gene knockin with mutationDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationR70WPromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-720 CTLA4-GFP R75W
Plasmid#186125PurposeCTLA4 gene knockin with mutationDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationR75WPromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-337 pUC19-tNGFR-P2A-CTLA4 N
Plasmid#186054PurposeKnockin of truncated NGFR to target geneDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationWT with tNGFR sequencePromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only