We narrowed to 19,449 results for: cat
-
Plasmid#178182PurposePlant binary vector expressing GFP by a enhanced 35S promoterDepositorInsertEGFP (eGFP )
ExpressionPlantMutationThe CAT is inserted after the start codon.PromoterThe minimal 35S promoter from Cauliflower Mosaic …Available sinceSept. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSico_U6-Pan-PGC1a sgRNA
Plasmid#165426PurposeExpression of gRNA against human Total PGC-1a variantsDepositorInsertgRNA against human Total PGC-1a variants (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-DIO-mCherry-TLR4miR-TLR2miR
Plasmid#137733PurposeLentivirus vector for TLR2/4 miR in a Cre-dependent mannerDepositorInsertTKR2/4 microRNA
UseLentiviralTagsmChherryExpressionMammalianAvailable sinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
FH95pUGW (B3)
Plasmid#74012Purposelentiviral expression of EGFP and Psd95 shRNADepositorPublicationInsertPsd95
UseLentiviral and RNAiExpressionMammalianPromoterH1Available sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBP-ORF
Plasmid#72949PurposeEntry vector for ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion sites. Stop codon must be included upstream of chosen 3' restriction siteDepositorPublicationInsertLevel 0 - ORFs
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEF1-FRT-HaloTag-RPA194-E593Q
Plasmid#247349PurposeExpresses HaloTag-RPA194-E593QDepositorInsertRPA194 (POLR1A) (POLR1A Human)
TagsHaloTagExpressionMammalianMutationRPA194 (POLR1A), mutated with E593QPromoterEF1αAvailable sinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-EGFP-coilin-FRT
Plasmid#247448PurposeFLP/FRT based mammalian expression vector for EGFP-coilin, driven by EF1α promoter.DepositorAvailable sinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF-1α-Venus-Nup107-FRT
Plasmid#247344PurposeExpresses Venus-NUP107 under EF1 promoter and can be integrated into FRT siteDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-HaloTag-FRT
Plasmid#247338PurposeExpresses H2B-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4-HaloTag-FRT
Plasmid#247452PurposeExpresses wild-type H4-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1-PA-GFP-H4-FRT
Plasmid#247333PurposeExpresses histone H4 fused with photoactivatable-GFPDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable sinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(HA)
Plasmid#195022PurposeGateway vector containing HA-tagged Creb5DepositorAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
eIF3e- pMK289 (mAID-mClover-NeoR) plasmid
Plasmid#192239Purposeknockin donor vector of mAID-mClover-NeoR to C-terminus of endogenous human eIF3eDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteIF3e-knockin-homology arm-mAID-mClover-NeoR (EIF3E Human)
ExpressionMammalianAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f- pMK293 (mAID-mCherry2-Hygro) plasmid
Plasmid#192242Purposeknockin donor vector of mAID-mCherry2-Hygro to C-terminus of endogenous human eIF3fDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteIF3f-knockin-homology arm-mAID-mCherry2-Hygro (EIF3F Human)
ExpressionMammalianAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only