We narrowed to 1,276 results for: Lentiviral mcherry
-
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.VSVg_mCherry-NLS
Plasmid#178246PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.S_mCherry-NLS
Plasmid#178245PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.VSVg_mCherry-NLS
Plasmid#178241PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.S_mCherry-NLS
Plasmid#178240PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.HSV_mCherry-NLS
Plasmid#178237PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.VSVg_mCherry-NLS
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9.mCherry
Plasmid#208342PurposeLentivirus with EF1a driven Cas9 linked (P2A) to mCherry.DepositorArticleInsertsCas9
mCherry
UseCRISPR and LentiviralTagsnuclear localization sequence (NLS) and FLAG tagPromoterEF-1aAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cdt1-mCherry-Puro
Plasmid#193763PurposeDoxycyline-inducible (TetOn) human Cdt1 (C-terminal mCherry tag), expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertCdt1-mCherry (CDT1 Human)
UseLentiviralTagsWTMutationhuman Cdt1 amino acids 1-100 w/ ΔCy mutation (aa6…PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFAP-CRY2PHR-P2A-CIBN-mCherry-VAMP2
Plasmid#178575PurposeLentiviral vector for GFAP::Opto-vTrapDepositorInsertCRY2PHR-P2A-CIBN-mCherry-VAMP2
UseLentiviralPromoterGFAPAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-SspB-mCh-p60
Plasmid#190170PurposeDoxycycline-inducible lentivirus vector to express SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.DepositorInsertSspBmicro-mCherry-p60
UseLentiviralTagsSspBmicro-mCherryAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT005-HaloGPM
Plasmid#163385Purpose2nd generation lentiviral vector to express sHalotag-sGFP module in the G-baToN systemDepositorInsertHalotag-GFP-PDGFRtm-2A-mCherry (HaloGPM)
UseLentiviralTagsmCherryExpressionBacterial and MammalianPromoterEF1aAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Caspase-Reporter
Plasmid#243673PurposeFluorescent Reporter for Caspase 3/7 activity. Contains DEVD sequence.DepositorInsertSplit-GFP with DEVD sequence and T2A mCherry
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mCherry-MinD-IRES-Puro
Plasmid#213112PurposeExpression of mCherry-MinD in mammalian cellsDepositorAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pCW-Cdt1ΔPIP-mCherry-Puro
Plasmid#193765PurposeDoxycyline-inducible (TetOn) human Cdt1ΔPIP (C-terminal mCherry tag), expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertCdt1ΔPIP-mCherry (CDT1 Human)
UseLentiviralTagsmCherryMutationPIP degron removed (a.a.1-19 removed)PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TetOn3G-T2A-mCherry (pSS059)
Plasmid#236350PurposeMTK transcriptional unit vector encoding the TetOn3G transcription factor and an mCherry transduction markerDepositorInsertEF1a-TetOn3G-T2A-mCherry
UseSynthetic BiologyPromoterEf1aAvailable SinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TetOn3G-T2A-mCherry (pSS060)
Plasmid#236351PurposeSecond generation lentivirus compatible transfer vector encoding the TetOn3G transcription factor and an mCherry transduction markerDepositorInsertEF1a-TetOn3G-T2A-mCherry
UseLentiviralPromoterEf1aAvailable SinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiX_EF1a-VP16-ZF37-2A-mCherry-BGH_pKG2943
Plasmid#246347PurposeZFa Lentivirus expressing VP16-ZF37-2A-mCherry from the EF1a promoterDepositorInsertVP16-ZF37-2A-mCherry
UseLentiviral and Synthetic BiologyMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only