We narrowed to 7,692 results for: Lif;
-
Plasmid#211332PurposeMammalian overexpression vector for C-terminally TwinStrep and His tagged human Ttyh1 (W417R)DepositorInsertTweety homology protein 1
UseLentiviralTagsTwinStrep, 10xHisExpressionMammalianMutationW417RPromoterCMVAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rif1-Halo HRD
Plasmid#207081PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169-Halo HRD
Plasmid#207083PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus.DepositorInsertHaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-AO-66-71-TVA950
Plasmid#217977PurposeAAV Transfer plasmid to express TVA950 in a Cre-dependent mannerDepositorInsertTVA950
UseAAVPromoternEFAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
TagsmCerulean3ExpressionMammalianPromoterCMV (+enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-dnHIF
Plasmid#206343PurposeAAV plasmid expressing dominant negative HIF1A in photoreceptorsDepositorInsertdominant negative hif1a
UseAAVMutationdominant negative HIF1APromoter1.7kb human red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shNC
Plasmid#206356PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptorsDepositorInsertNon-targeting control shRNA
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only