We narrowed to 10,492 results for: nar
-
Plasmid#103077PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertF4GDP9(Cas9 coding gene from Alicycliphilus denitrificans (strain DSM 14773 / CIP 107495 / K601))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-K2FTY8
Plasmid#103079PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertK2FTY8(Cas9 coding gene from Alcanivorax pacificus W11-5)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A8LN05
Plasmid#103083PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA8LN05(Cas9 coding gene from Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B1UZL4
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B8I085
Plasmid#103089PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB8I085(Cas9 coding gene from Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q5L8F8
Plasmid#103126PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ5L8F8(Cas9 coding gene from Bacteroides fragilis (strain ATCC 25285 / NCTC 9343))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE MD-deltaN-ER
Plasmid#13496DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Human, Mouse)
UseRetroviralTagsExpressionMammalianMutationMyoD (containing a deletion in aa3-56) was fused …PromoterAvailable sinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXC1-T2A-miRFP670
Plasmid#182336PurposeExpresses human FOXC1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box C1 (FOXC1 Human)
UseTagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianMutationPromoterCMVAvailable sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 N-T2A-M-IRES-E
Plasmid#231903PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '3-plasmid' systemDepositorUseTagsExpressionMammalianMutationR203M in N proteinPromoterCMVAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K20-P2A-mCherry
Plasmid#185618PurposeRibosomal stalling reporter: positive controlDepositorInsertGFP-K20(AAA)-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K0-P2A-mCherry
Plasmid#185619PurposeRibosomal stalling reporter: emptyDepositorInsertGFP-empty-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-I15-P2A-mCherry
Plasmid#185620PurposeRibosomal stalling reporter: 15x isoleucineDepositorInsertGFP-I15-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.1-GFP (pc2188)
Plasmid#223707PurposeExpression of macroH2A1.1 tagged N-terminal to GFPDepositorInsertmacroH2A1.1-GFP (Macroh2a1 Rat)
UseTagsGFPExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.2-GFP (pc2189)
Plasmid#223708PurposeExpression of macroH2A1.2 tagged N-terminal to GFPDepositorInsertmacroH2A1.2-GFP (Macroh2a1 Rat)
UseTagsGFPExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR051
Plasmid#185029Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-51 and 80-84 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 47-51 & 80-84 mutated rpmE 5'…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only