We narrowed to 9,075 results for: sgRNA
-
Plasmid#137929PurposeExpression of cjCas9 with Hif1a targeting sgRNADepositorInsertCjCas9
UseAAV and CRISPRTagsSV40NLS-HA-T2A-EGFPPromoterEF-1alphaAvailable sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC153-dual-dCas9VP96-sgExpression
Plasmid#48239PurposeDual expression construct expressing both dCas9VP96 and sgRNA from separate promotersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP96ExpressionMammalianMutationD10A H840AAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgTfeb (Tfeb Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting DNA-PKcs (PRKDC) exon 1 (PRKDC Human)
UseCRISPRPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
Plasmid#138525PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt control A-tract repeat RNA sequence.DepositorInsertControl non-PRC2 binding A-tract repeat RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_ASCL1
Plasmid#64130PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
IR InterIR gRNA #5
Plasmid#247547Purposenegative control for Crispri KDDepositorInsertnegative control sgRNA targeting region between inverted repeats of Distal Junction
UseCRISPRExpressionMammalianMutationnoneAvailable sinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
InterIR gRNA #2
Plasmid#247546Purposenegative control for Crispri KDDepositorInsertnegative control sgRNA targeting region between inverted repeats of Distal Junction
UseCRISPRExpressionMammalianMutationnoneAvailable sinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNB-Rep
Plasmid#238996PurposeNode B carrying the sfGPF reporter that can be used for the assembly of pEND-11Y, pEND-Y11, pEND-Z11 or pEND-ZYDepositorInsertsfGFP-MarAn10 downstream of a strong constitutive promoter and a binding site for sgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1-1)-PGKpuroBFP-W
Plasmid#211954PurposeExpress safe-cutter control gRNA with puro and BFPDepositorInsertsafe-cutter control sgRNA_AAVS1-1 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1-2)-PGKpuroBFP-W
Plasmid#211955PurposeExpress safe-cutter control gRNA with puro and BFPDepositorInsertsafe-cutter control sgRNA_AAVS1-2 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato90/816
Plasmid#188487PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 90 & 816.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0055
Plasmid#117622PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for Sp-eCas9 1.1(pEPOR1CB0011) and sgRNA_Methyltransferase {AT5G10620}(pEPOR1CB0083)DepositorInsert[35S:Sp-eCas9 1.1(pEPOR1CB0011) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only