We narrowed to 171,035 results for: Gene
-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMVp_eGFP
Plasmid#241002PurposeFor targeted gene knock-in at NHP IGH locus and constitutive expression of GFPDepositorAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVH4p_eGFP
Plasmid#241003PurposeFor targeted gene knock-in at NHP IGH locus and B cell-specific expression of GFPDepositorAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-GFP-WPRE-miR124T
Plasmid#245069PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP956
Plasmid#239878PurposeTCTP-SynPro-09 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-09::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP957
Plasmid#239879PurposeTCTP-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP958
Plasmid#239880PurposeTCTP-SynPro-11 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-11::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP953
Plasmid#239875PurposeTCTP-SynPro-06 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-06::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP954
Plasmid#239876PurposeTCTP-SynPro-07 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-07::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP967
Plasmid#239889PurposeCaMV 35S-SynPro-02 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-02::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP965
Plasmid#239887PurposeWild type CaMV 35S promoter engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP966
Plasmid#239888PurposeCaMV 35S-SynPro-01 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-01::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP968
Plasmid#239890PurposeCaMV 35S-SynPro-03 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-03::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP969
Plasmid#239891PurposeCaMV 35S-SynPro-04 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-04::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP970
Plasmid#239892PurposeCaMV 35S-SynPro-05 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-05::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP977
Plasmid#239899PurposeCaMV 35S-SynPro-12 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-12::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only