-
Plasmid#97322PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.DepositorInsertSox2 HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC-mhc2.4kb-TALE3-VP64-P10
Plasmid#104611PurposeExpresses TALE3 under the control of a 2.4kb mhc enhancer elementDepositorInsert2.4kb mhc enhancer element (Mhc Fly)
UseTALENTagsExpressionInsectMutationPromoterhsp70Available sinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-XRCC1-gRNA res-Neo
Plasmid#176149PurposeXRCC1 with dual PAM resistance to XRCC1 gRNA1 and XRCC1 gRNA2 & a neomycin/G418 resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralTagsExpressionMammalianMutationDual PAM resistance to XRCC1 gRNA 1 and XRCC1 gRN…PromoterCMVAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
p17xQUAS-Luciferase, α-cry:mCherry
Plasmid#180482PurposeInducible gene expression vector p17xQUAS-Luciferase, α-cry:mCherryDepositorInsertsLuciferase
17x QUAS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
UseTagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H150
Plasmid#170345Purpose6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsert6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit (RAPGEF3 Human)
UseTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-Puro
Plasmid#110851PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGExpressionMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Cdx2 HMEJ donor
Plasmid#97319PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Cdx2. AAV backbone.DepositorInsertCdx2 HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-LMNA
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
Plasmid#160646PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KA801: pMVP (L3-L2) HA tag + pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGExpressionMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations (NT51)
Plasmid#49061PurposeExpresses human NKCC1 mutated Ser and Thr residues in the N-terminus and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationS150N, S155Q, S170Q, T177A, S183R, S193E, T203A, …PromoterCMVAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-PGK-Puro
Plasmid#110858PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGExpressionMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_Dbh HMEJ donor
Plasmid#97320PurposeHMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.DepositorInsertDbh HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-N
Plasmid#156469PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-N protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-N (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
UseTagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-M
Plasmid#156470PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-M protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-M (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
UseTagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PI3KC2alpha-PX (1405-1545)
Plasmid#119119PurposeBacterial expression of human phox homology (PX) domain, PI3KC2alpha-PX (1405-1545)DepositorInsertPI3KC2alpha-PX (1405-1545) (PIK3C2A Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-PGK-Puro
Plasmid#110859PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-Puro
Plasmid#110852PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF6x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235307PurposeLentiviral expression of ComMAND open-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianMutationPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235304PurposeLentiviral expression of ComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF4x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235308PurposeLentiviral expression of ComMAND closed-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianMutationPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235305PurposeLentiviral expression of ComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCpep-E1GFP
Plasmid#233884PurposeExpression of a pH sensitive variant of EGFP inserted in the C-peptide of insulin for pH measurement in insulin secretory granulesDepositorInsertProinsulin-E1GFP (Ins2 Mouse)
UseTagsExpressionMammalianMutationInserted E1GFP into C-peptide of mouse Ins2 codin…PromoterCMVFAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-fli1-lsl-AmCyan-mScarlet; hsp70-zfCre-I-BFP (JDW 1234)
Plasmid#229810PurposeA Tol2 based expression vector containing fli1 driven switch reporter (loxP flanked AmCyan followed by a mScarlet-I) and a hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-AmCyan-stop-lox
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry-hsp70-zCreI-mTagBFP2 (JDW 1235)
Plasmid#229814PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseCre/Lox; Tol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
UseTagsHA tag and Mating factor alpha secretion signalExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L
Plasmid#224381PurposeLenti plasmid for generating GNB1L expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_TELO2_gRNA
Plasmid#224379PurposeTargets TELO2 for dTAG N terminal knock-in cell linesDepositorInsertTELO2 (TELO2 Human)
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E stop
Plasmid#224581PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 lacking its PBM in mammalian cellsDepositorInsertSARS-CoV-2E stop (E SARS-CoV-2)
UseTagsGFPExpressionMammalianMutationstop codon before PBMPromoterCMVAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual
Plasmid#207883PurposeExpresses thermosensitive variants of the homing endonucleases I-OnuI and I-GpeMI, each in a different open reading frame. Both were made thermosensitive by a fusion with the L212P VMA1 intein.DepositorInsertsThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
Thermosensitive fusion of I-GpeMI and the L212P VMA1 intein.
UseSynthetic BiologyTagsExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in th…PromoterAvailable sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGhMeCP2 (pc3972)
Plasmid#212033PurposeExpresses human MeCP2 tagged N-terminal to Halo-tagDepositorInsertMeCP2 (MECP2 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-SET-EMD (N-SET-EMD)
Plasmid#217765PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
UseTagsEGFPExpressionMammalianMutationEMD domain (aa 70-226)PromoterCMVAvailable sinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSET-EMD-EGFP (C-SET-EMD)
Plasmid#217764PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
UseTagsEGFPExpressionMammalianMutationEMD domain (aa 70-226)PromoterCMVAvailable sinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNES-PRKCZ-C20-EGFP (C-NES-PRKCZ-C20)
Plasmid#217763PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
UseTagsEGFPExpressionMammalianMutationNES (ALQKKLEELELDEAPVAT) plus C20 domain (aa 405-…PromoterCMVAvailable sinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-KSR1-CA3 (N-KSR)
Plasmid#217755PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterCMVAvailable sinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKSR1-CA3-GS-mRFP1 (C-KSR-GS)
Plasmid#217758PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsmRFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable sinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable sinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGM238
Plasmid#220178PurposeExpresses exogenous ribosomal-binding domain mutant NAC complex members (K78E NACA and K43E BTF3)DepositorUseLentiviralTags3xFLAG (NACA); 6xHis (BTF3)ExpressionMutationK78E (NACA) + K43B (BTF3)PromoterAvailable sinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-pSM
Plasmid#215871PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInsert3 tandem repeats of target site (complementary to seed seq of passenger strand of siRNA for VIM) is inserted to 3'UTR of RLuc (VIM Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only