We narrowed to 3,878 results for: Atr
-
Plasmid#38880PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only
-
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1P2-PTPN22
Plasmid#195391PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 and P2 domains) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP2-PTPN22
Plasmid#195395PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P2 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1-PTPN22
Plasmid#195388PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.S295L.RFP.P2A.PURO.JL.p163
Plasmid#170174PurposeLentiviral Expression of EF1a.SLC6A1.S295L.RFPDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.A288V.P2A.PURO.JL.p166
Plasmid#170171PurposeLentiviral Expression of EF1a.SLC6A1.A288VDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK587
Plasmid#71696PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag and Cys138>Ser mutant (AaTrxB1H6-C138S)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB33eCPX
Plasmid#23336DepositorInsertEnhanced Circularly Permuted Outer Membrane Protein X
ExpressionBacterialAvailable SinceMarch 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
YPet-pBAD
Plasmid#54860PurposeLocalization: Protein Expression Vector , Excitation: 513, Emission: 527DepositorTypeEmpty backboneTags6xHis and YPetExpressionBacterialAvailable SinceJuly 25, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIVTR(T7A)-SOX9
Plasmid#172302PurposeIn vitro transcription of SOX9DepositorAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2617
Plasmid#234496PurposeNATR-CnU6-empty sgRNADepositorInsertNAT-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP1-3
Plasmid#71258Purposeluciferase reporter with 3 copies of the stromelylisin gene AP-1 site in front of hGM-CSF -55 to +28 minimal promoterDepositorInsert3 copies of an AP-1 site from the human Stromelysin-1 gene (MMP3 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSF minimalAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-MetN
Plasmid#114458PurposeExpression of hexahistidine-tagged AceS methylase in E. coliDepositorInsertaceS
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIAGO-aceS
Plasmid#114456PurposeExpression of AceS methylase in streptomycetesDepositorInsertaceS
ExpressionBacterialPromoterermEAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-EpoRtm
Plasmid#114286PurposeTET-inducible expression of Erythropoietin receptor without cytoplasmic tailDepositorInsertErythropoietin Receptor (Epor Rat)
UseLentiviralMutationdeletion of the cytoplasmic domainAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Foxd3 LCA TV
Plasmid#37271DepositorInsertFoxd3 (Foxd3 Mouse)
UseMouse TargetingAvailable SinceAug. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-JRGECO1a
Plasmid#128317PurposeExpresses JRGECO1a under control of eukaryotic Ef1a promoter after Flp-dependent recombination.DepositorHas ServiceAAV1InsertNES-JRGECO1a
UseAAVTagsHis TagExpressionMammalianPromoterEf1aAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only