We narrowed to 8,311 results for: Dos
-
Plasmid#106206PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72A + mRuby3 fusionPromoterCAGAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.SF-Venus-iGluSnFR.A184V
Plasmid#106202PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GOPC_WT
Plasmid#82924PurposeGateway Donor vector containing GOPC, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCX:Gachapin-4B-P2A-EBFP2-NLS
Plasmid#251134PurposeGachapin-B with a transfection marker EBFP2-NLSDepositorInsertGachapin-4B
TagsP2A-EBFP2-NLSExpressionMammalianPromoterChicken β-actin promoterAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNb4OMT-A53M
Plasmid#216232PurposeExpresses a mutant Norbelladine 4'-O-MethyltransferaseDepositorInsertNb4OMT-A53M
UseSynthetic BiologyMutationA53MPromoterP150Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn PGK1
Plasmid#220919PurposeNeuronal specific expression of PGK1DepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC14
Plasmid#197408PurposeHoney bee gut symbiont broad-host range vector with constitutive GFP, ampR and pTFC-FC2 repliconDepositorInsertpTF-FC2 replicon
UseSynthetic BiologyAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR RPS27A-3xFlag_IRES-GFP
Plasmid#198390PurposeRPS27A (ubiquitin/ribosomal protein eS31 fusion) expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+/C-SNAPf
Plasmid#184416Purposevector backbone to clone insert upstream of SNAPf tag (SNAPf tag codon optimized for Xenopus), for mRNA synthesisDepositorTypeEmpty backboneUseFor mrna synthesisTagsSNAPf-tagMutationCodon optimized for expression in Xenopus laevis …Available SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
NTERY00
Plasmid#184109PurposeNanopore-addressable protein reporter for expression in bacterial cells.DepositorInsertNTERY00
ExpressionBacterialPromoterT7Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
NTERY02
Plasmid#184120PurposeNanopore-addressable protein reporter for expression in bacterial cells.DepositorInsertNTERY02
ExpressionBacterialPromoterT7Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_KEAP1_KELCH
Plasmid#178496PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_TNKS_TANK-peptide-bind
Plasmid#178489PurposeBacterial expression of human domain with His-tag and GST tagDepositorInsertTNKS_TANK-peptide-bind (TNKS Synthetic, Human)
TagsHis-GSTExpressionBacterialPromoterT7/LacOAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_MAD2L1_HORMA
Plasmid#178480PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_ZYMND11_coiled-coil MYND
Plasmid#178493PurposeBacterial expression of human domain with His-tag and GST tagDepositorInsertZYMND11_coiled-coil MYND (ZMYND11 Synthetic, Human)
TagsHis-GSTExpressionBacterialPromoterT7/LacOAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_IRF3_SMAD/FHA
Plasmid#178479PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2124
Plasmid#178791PurposePrgef-1 EGL-3 unc-54 3' UTR C.elegans pan-neural expression of EGL-3DepositorAvailable SinceJan. 5, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2930
Plasmid#175283PurposePges-1 DAF-16a unc-54 3' UTR C.elegans gut expression of isoform a of DAF-16DepositorAvailable SinceDec. 3, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2972
Plasmid#175285PurposePmyo-3 GFP::DAF-16a unc-54 3' UTR C.elegans muscle expression of isoforms a of DAF-16DepositorAvailable SinceNov. 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits