We narrowed to 68,463 results for: nin
-
Plasmid#153538PurposeAAV-mediated expression of Jaws-tdTomato-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F2-empty vector
Plasmid#125552PurposeN2H assay vector with nanoluc fragment2 (empty control, no Gateway cloning site, expressing nanoluc fragment2)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F1-empty vector
Plasmid#125551PurposeN2H assay vector with nanoluc fragment1 (empty control, no Gateway cloning site, expressing nanoluc fragment1)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Isl1_2A_Lhx3-BSD
Plasmid#226282PurposeTetracycline-inducible expression of Isl1 and Lhx3 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsIsl1 and Lhx3 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Ngn2_2A_Sox11-PURO
Plasmid#226284PurposeTetracycline-inducible expression of Ngn2 and Sox11 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsNGN2 and SOX11 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
Plasmid#246647PurposeExpresses AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003 in bacterial cells for calcium-induced NeissLock protein ligationDepositorInsertAviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
TagsAviTag, His-tag, and SpyTag003ExpressionBacterialMutationOrinithine Decarboxylase Antizyme (OAZ) with C175…PromoterT7Available SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mTagBFP2-KRAS4A-WT (JDW 831)
Plasmid#242568PurposeGateway middle entry clone containing an mTagBFP2 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-WT (JDW 812)
Plasmid#242566PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
cDNA5-FRT/TO-APT2-LAMA-F98
Plasmid#234427PurposeExpress APT2 with a C terminal fusion to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position F98DepositorInsertAPT2 fused to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position F98 (LYPLA2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-APT2-LAMA-G97
Plasmid#234426PurposeExpress APT2 with a C terminal fusion to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position G97DepositorInsertAPT2 fused to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position G97 (LYPLA2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R82A_pET-14b
Plasmid#233276PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 82 was substituted with alanine (R82A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 82…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R64A_pET-14b
Plasmid#233263PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 64 was substituted with alanine (R64A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 64…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
HemH-R212A_pET-14b
Plasmid#233262PurposeOverexpress his-tag HemH protein with a site directed mutagenesis, arginine at position 212 was substituted with alanine (R121A)DepositorInsertHemH (hemH )
ExpressionBacterialMutationArginine was replaced with Alanine at position 21…PromoterT7 promoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry-hsp70-zCreI-mTagBFP2 (JDW 1235)
Plasmid#229814PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-NE
Plasmid#215487PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only