-
Plasmid#106249PurposeLentiviral vector with puro selection for expression of S. aureus dCas9-KRABDepositorInsertdead S. aureus Cas9 KRAB T2A PuroR
UseCRISPR and LentiviralTagsHA-NLS and NLS-KRABExpressionMammalianMutationD10A and N580APromoterhUbCAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABExpressionMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64ExpressionMutationPromoterAvailable sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterCBAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only