We narrowed to 856 results for: V2
-
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-palmitoyl-mTagBFP2-BsmBI_entry (pRW1509)
Plasmid#225755PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with membrane-localized palmitoyl-mTagBFP2; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF2-V2-FLAG-IRES-GFP
Plasmid#69049Purposelentiviral expression of IKZF2 variant 2 with FLAG tagDepositorInsertIKZF2 (IKZF2 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationsplice variant 2PromoterCAGAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-IKZF1-V2-3xHA-pGK-Pur
Plasmid#69051Purposelentiviral expression of IKZF1 with HA tagDepositorInsertIKZF1 (IKZF1 Human)
UseLentiviralTagsHAExpressionMammalianMutationsplice variant 2PromoterUBCAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-IKZF2-V2-3xHA-pGK-Pur
Plasmid#69052Purposelentiviral expression of IKZF2 variant 2 with HA tagDepositorInsertIKZF2 (IKZF2 Human)
UseLentiviralTagsHAExpressionMammalianMutationsplice variant 2PromoterUBCAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-Tev-MS2-p65-HSF1
Plasmid#84513PurposeMESA protease chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, and Tev protease, MS2-P65-HSF1DepositorInsertsV2-MESA-35F-Tev
MS2-P65-HSF1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
XZ032 CMV-TO-CCR6-V2-ADAR2dd(E488Q, T501A)
Plasmid#233394PurposeCCR6-V2-ADAR2dd(E488Q, T501A) with a short 4 amino acid linker and V2 tailDepositorInsertCCR6-ADAR2dd
ExpressionMammalianMutationE488Q, T501A on ADAR2ddPromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-GFP-Kir2.1-HA-tevs-RXR-V2
Plasmid#179705PurposeTEVP-inducible GFP-conjugated Kir2.1 RELEASEDepositorInsertKir2.1
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-mCherry-Kir2.1-HA-tvmvs-RXR-V2
Plasmid#179707PurposeTVMVP-inducible mCherry-conjugated Kir2.1 RELEASEDepositorInsertKir2.1
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 OCT4p eGFP SV40pA v2
Plasmid#115518PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows OCT4 dependent expression of GFP, and contains cHS4 insulators.DepositorInserteGFP
UseAAV; Donor plasmid for recombinase-mediated casse…ExpressionMammalianAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only