We narrowed to 17,638 results for: URE
-
Plasmid#192763PurposeExpresses NG-tagged MCRaeo in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-EGFP barcode-7-SV40 polyA
Plasmid#190871PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode7
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-8-SV40 polyA
Plasmid#190872PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode8
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-6-SV40 polyA
Plasmid#190870PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode6
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW299-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-tagBFP-P2A-BlastR
Plasmid#189943PurposeLentiviral vector to co-express an spsgRNA with NLS-tagBFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP7_rpoA-U
Plasmid#190974PurposeTest the U-to-C editing activity of KP7 on AtrpoA editing site, in E. coliDepositorInsertPLS-KP7
TagsHisExpressionBacterialPromoterT7Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP2-E67A_rpoA-U
Plasmid#190959PurposeTest the U-to-C editing activity of KP2:E67A on AtrpoA editing site, in E. coliDepositorInsertPLS-KP2
TagsHisExpressionBacterialMutationDYW-KP:E67APromoterT7Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP6-A66S_rpoA-C
Plasmid#190968PurposeTest the C-to-U editing activity of KP6:A66S on AtrpoA editing site, in E. coliDepositorInsertPLS-KP6
TagsHisExpressionBacterialMutationDYW-KP:A66SPromoterT7Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
PM18033-PLS-KP5_rpoA-U
Plasmid#190985PurposeTest the U-to-C editing activity of KP5 on AtrpoA editing site, in human cellsDepositorInsertPLS-KP5
TagsHisExpressionMammalianPromoterCMVAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP1_rpoA-U
Plasmid#190955PurposeTest the U-to-C editing activity of KP1 on AtrpoA editing site, in E. coliDepositorInsertPLS-KP1
TagsHisExpressionBacterialPromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP2-A66S_rpoA-U
Plasmid#190957PurposeTest the U-to-C editing activity of KP2:A66S on AtrpoA editing site, in E. coliDepositorInsertPLS-KP2
TagsHisExpressionBacterialMutationDYW-KP:A66SPromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP3-A66S_rpoA-U
Plasmid#190961PurposeTest the U-to-C editing activity of KP3:A66S on AtrpoA editing site, in E. coliDepositorInsertPLS-KP3
TagsHisExpressionBacterialMutationDYW-KP:A66SPromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PM18033-PLS-KP7_rpoA-U
Plasmid#190994PurposeTest the U-to-C editing activity of KP7 on AtrpoA editing site, in human cellsDepositorInsertPLS-KP7
TagsHisExpressionMammalianPromoterCMVAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP3-E67A_rpoA-U
Plasmid#190963PurposeTest the U-to-C editing activity of KP3:E67A on AtrpoA editing site, in E. coliDepositorInsertPLS-KP3
TagsHisExpressionBacterialMutationDYW-KP:E67APromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP4_rpoA-U
Plasmid#190964PurposeTest the U-to-C editing activity of KP4 on AtrpoA editing site, in E. coliDepositorInsertPLS-KP4
TagsHisExpressionBacterialPromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP6-E67A_rpoA-C
Plasmid#190972PurposeTest the C-to-U editing activity of KP6:E67A on AtrpoA editing site, in E. coliDepositorInsertPLS-KP6
TagsHisExpressionBacterialMutationDYW-KP:E67APromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PM18033-PLS-KP4_rpoA-U
Plasmid#190984PurposeTest the U-to-C editing activity of KP4 on AtrpoA editing site, in human cellsDepositorInsertPLS-KP4
TagsHisExpressionMammalianPromoterCMVAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-PLS-KP5_rpoA-U
Plasmid#190965PurposeTest the U-to-C editing activity of KP5 on AtrpoA editing site, in E. coliDepositorInsertPLS-KP5
TagsHisExpressionBacterialPromoterT7Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr-CM
Plasmid#188585PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler Catalytic mutant
TagsFLAG-MycExpressionInsectMutationdeleted first ATG; D435A [GAT=>GCC]; E435A [GA…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[N1-383]
Plasmid#188586PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler N-terminal domain
TagsFLAG-MycExpressionInsectMutationdeleted first ATGAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[C399-625]
Plasmid#188587PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler C-terminal domain
TagsFLAG-MycExpressionInsectAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXPHM3-NB-D6
Plasmid#167989Purposeexpression of a nanobody against rat PepT2 as a n terminal MBP fusionDepositorInsertNanobodyD6
TagsHis-MBPExpressionBacterialPromoterpBADAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2369-Tier1-PhCMV_KRAB
Plasmid#169571PurposeTier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).DepositorInsertPCMV-driven Kruppel associated box domain
ExpressionMammalianPromoterPhCMVAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.22
Plasmid#183566PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 22
ExpressionMammalianPromoterCBhAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-EF1a.13
Plasmid#183576PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated EF1a promoter, Fig 3)DepositorInsertAttenuator Sequence 13
ExpressionMammalianPromoterEF1aAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2341_Tier3(SB)-Puro
Plasmid#169639PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH228-Tier1-OVanO2-PCMVmin2-SEAP
Plasmid#169564PurposeTier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).DepositorInsertvanillic acid-controlled SEAP production
ExpressionMammalianPromoterVanO2-PCMVminAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-F>E
Plasmid#185508PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationF>EAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH1001-Tier2(ColE1 ori)
Plasmid#169599PurposeTier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2351_Tier3(SB)-Zeo
Plasmid#169648PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a ZeoR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-ZeoR-pA-3'ITR)DepositorInsertPRPBSA-driven ZeoR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1040
Plasmid#169618PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1039
Plasmid#169617PurposeTier-2 vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP
ExpressionMammalianPromoterPhCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.7
Plasmid#183581PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 7
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.5
Plasmid#183580PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 5
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.9
Plasmid#183582PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 9
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.11
Plasmid#183583PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 11
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.6
Plasmid#183559PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 6
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.8
Plasmid#183560PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 8
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.13
Plasmid#183562PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 13
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.4
Plasmid#183558PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 4
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.14
Plasmid#183563PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertKDR-CBh.14
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.18
Plasmid#183564PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 18
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.10
Plasmid#183561PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 10
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-NegCon
Plasmid#183554PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)DepositorInsertLuciferase shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only