We narrowed to 81,768 results for: TRI
-
-
pB18cmBFPAzurite
Plasmid#14034DepositorInsertAzurite
UseYeast/bacteria optimized codonsTags6xHisExpressionBacterialAvailable SinceFeb. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
AnkyrinB-GFP/pEGFP-N1
Plasmid#197327PurposePlasmid expressing an antigen targeting AnkyrinBDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pPK605
Plasmid#38148DepositorInsertsunc-119 rescuing fragment (unc-119 promoter, unc-119 and unc-119 3'UTR) (unc-119 Nematode)
pie-1 promoter - unique MluI/BamHI cloning site - pie-1 3'UTR
ExpressionWormPromoterpie-1 promoter and unc-119Available SinceOct. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
O-TREM2-2
Plasmid#166545PurposescFv of a human scaffold targeting Triggering receptor expressed on myeloid cells 2. Antigen coverage aa 19-131 of 230DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pKM596
Plasmid#8837DepositorTypeEmpty backboneTagsE. coli MBPExpressionBacterialAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
HCN4/EGFP-C1
Plasmid#197389PurposePlasmid expressing an antigen targeting the HCN4 ion channel subunitDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP84
Plasmid#86554PurposeExpresses sLucopt luciferase from the constitive Bacillus subtilis promoter Pveg in Clostridium difficileDepositorInsertPveg-sLucopt
UseLuciferase and Synthetic BiologyExpressionBacterialPromoterPvegAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
HCN3/pCDNA3.1
Plasmid#197293PurposePlasmid expressing an antigen targeting the HCN3 ion channel subunitDepositorInsertHCN3 (Hcn3 Mouse)
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB18cmBFP1A5
Plasmid#14035DepositorInsertBFP1A5
UseYeast/bacteria optimized codonsTags6xHisExpressionBacterialAvailable SinceFeb. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
KCNQ4-Myc
Plasmid#197329PurposePlasmid expressing an antigen targeting the KCNQ4/Kv7/4 K+ channel subunitDepositorAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
25 pCOLI_S_NoTag
Plasmid#160261PurposeUntagged Spec resistant bacterial expression vectorDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
41 pCOLI_K_NoTag
Plasmid#160265PurposeUntagged Kan resistant bacterial expression vectorDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM839
Plasmid#8838DepositorTypeEmpty backboneTagsP. furiosus MBPExpressionBacterialAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
64 pCOLI_G2
Plasmid#160206PurposeGentamycin resistant polycistronic host vectorDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHT-497
Plasmid#87756PurposeBacterial expression vector for producing 6x histidine tagged rat DYRK1A kinase domain (residues 1-497)DepositorInsertGene coding for rat DYRK1A kinase domain (residues 1-497)
Tags6X histidine tagExpressionBacterialPromoterT7 RNA polymerase promoterAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
1 pCOLI_A_NoTag
Plasmid#160143PurposeUntagged Amp resistant bacterial expression vectorDepositorTypeEmpty backboneTagsNoneExpressionBacterialPromoterT7Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM1000
Plasmid#8840DepositorTypeEmpty backboneTagsT. maritima MBPExpressionBacterialAvailable SinceNov. 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJF1106
Plasmid#8836DepositorTypeEmpty backboneTagsYersinia pestis MBPExpressionBacterialAvailable SinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
pKM1137
Plasmid#8841DepositorTypeEmpty backboneTagsV. cholera MBPExpressionBacterialAvailable SinceNov. 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
DsRed1 Munc13-4
Plasmid#245001PurposeDistribution and localization of human wild-type Munc13-4 in cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Munc13-4
Plasmid#244996PurposeDistribution and localization of human wild-type Munc13-4 in cellsDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-cytUnaG
Plasmid#220101PurposeFor Agrobacterium-mediated transformation. Cytosol-localized mCherry-UnaG.DepositorInsertmCherry-UnaG
ExpressionPlantAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
emiRFP 670 Rab3a Q81L
Plasmid#245018PurposeDistribution and localization of rat Rab3a Q81L mutantDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEmerald MADD
Plasmid#245051PurposeDistribution and localization of human wild-type MADD in cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a T36N
Plasmid#245014PurposeDistribution and localization of rat Rab3a T36N mutantDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/MYB60
Plasmid#140408PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CAB3
Plasmid#140410PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1A
Plasmid#140411PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1B
Plasmid#140412PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1C
Plasmid#140413PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1D
Plasmid#140414PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/35S
Plasmid#140415PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the CaMV35S promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/PGC1
Plasmid#140416PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/MYB60
Plasmid#140417PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CAB3
Plasmid#140419PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1A
Plasmid#140420PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1B
Plasmid#140421PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1C
Plasmid#140422PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1D
Plasmid#140423PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/UBQ10
Plasmid#140406PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana UBQ10 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/PGC1
Plasmid#140407PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only