We narrowed to 10,981 results for: Vars;
-
Plasmid#172148PurposeAccessory Plasmid for PACE of pylBCD variantsDepositorInsertPpsp gIII.1TAG, luxAB; Plpp [eG SD8] 32A-Nter; PproK pylT
UseTagsExpressionBacterialMutationgIII(P29*); [strong promoter eG, strong RBS SD8] …PromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Negative feedback (NF) plasmid
Plasmid#169747PurposeStandalone NF circuit plasmid that has the same implementation of the NF subcircuit in Equalizers.DepositorInserttetR-P2A-eGFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMV-tetO2Available sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS11: pTns(AvCAST)_ΔTniQ,ΔTnsD
Plasmid#168144PurposeInducible expression of AvCAST TnsA, TnsB and TnsC proteins.DepositorInsertAvCAST Tns proteins (TnsA, TnsB and TnsC)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS9: pTns(AvCAST)_ΔTniQ
Plasmid#168142PurposeInducible expression of AvCAST TnsA, TnsB, TnsC and TnsD proteins.DepositorInsertsAvCAST Tns proteins (TnsA, TnsB and TnsC)
AvTnsD
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
RCP83
Plasmid#163466PurposeBackbone plasmid for insertion of the Saccharomyces cerevisiae promoter library and yeGFPDepositorInsertsPromoter fragment (Sharon2012_1922)
His3 minimal promoter
yeGFP
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
UseTagsExpressionMutationPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQP-2376
Plasmid#138974PurposeLight-induced recruitment of NSImb-QPAS1-mCherry to the target protein bound to membrane; interaction occurs via intrabody fused to BphP1DepositorInsertNcoI-mVenus-CAAX-IRES2-BphP1- iB(GFP)- IRES2-NSImb-NES-mCh-Q-PAS1-NotI
UseTagsExpressionMutationPromoterAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIs8-4b-SaDAH::G226D
Plasmid#140130PurposeExpresses SaDAH::G226D variant with N-terminal 8xHis-tag in BL21 E. coliDepositorInsertDechloroacutumine halogenase G226D variant from Sinomenium acutum
UseTags8x-His, TEV protease site (ENLYFQ)ExpressionBacterialMutationchanged Gly226 to Asp226PromoterT7Available sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYMH 539
Plasmid#138078PurposeControl vector with no degradation tag to compare against various degradation tag variantsDepositorInsertJ23104-mCherry::sbfI- pSEVA-331Bb
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T3-HypaCAS9-pA
Plasmid#131467PurposeExpresses HypaCas9 nuclease in mammalian cells. Used to modify genome of mouse embroysDepositorInsertCodon optimized HypaCas9
UseCRISPRTagsFlag, NLS, and polyAExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-nolinker-GFP
Plasmid#108579PurposeExpresses PKAcs-GFP fusion in mammalian cellsDepositorInsertprotein kinase A, catalytic subunit
UseTagsGFPExpressionMammalianMutationH87Q and W196RPromoterAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only