We narrowed to 10,377 results for: plasmids 101
-
Plasmid#207506PurposeThis plasmid can be used to generate retrovirus.DepositorInsertJUN, HA-GD2-28z_CAR (JUN Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-830_HA-GD2-28z_CAR_tNGFR_Retroviral
Plasmid#207507PurposeThis plasmid can be used to generate retrovirus.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-828_HA-GD2-28z_CAR_BATF_Retroviral
Plasmid#207505PurposeThis plasmid can be used to generate retrovirus.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Δ18 D614G
Plasmid#164437PurposeEncodes SARS-CoV-2 Spike Protein lacking 18 C-terminal amino acids and D614G mutation for pseudovirus productionDepositorInsertSARS-CoV-2 Spike D614G variant truncated to remove 18 amino acids (S )
ExpressionMammalianAvailable SinceFeb. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP
Plasmid#141210Purposeempty GFP vector for cloning sgRNA or pgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY088_AAV_EFS-BCMA-41BBz-PRODH2
Plasmid#192191PurposeBCMA CAR AAV vector PRODH2 KI (pLY088)DepositorInsertBCMA CAR AAV vector PRODH2 KI (pLY088) (TNFRSF17 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614G soluble Spike
Plasmid#164651PurposeExpresses SARS-CoV-2 soluble Spike protein with a D614G mutationDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
TagsHISExpressionMammalianMutationD614GPromoterCAGAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.25_S3-4-5-6
Plasmid#173956PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertEnhancer regions 3-6 (S3, S4, S5 and S6) from SOX9 enhancer cluster EC1.25
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 BA.4 (V3G,S658N)
Plasmid#212504PurposeEncodes SARS-CoV-2 variant BA.4 Spike V3G,S658N for pseudovirus productionDepositorInsertSARS-CoV-2 Spike BA.4 (contains third aa mutation and without N658S) (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-806_HA-GD2-28z_CAR_RFP-TFAP4
Plasmid#207493PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-851_HA-GD2-28z_HA-TFAP4
Plasmid#207501PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertHA-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGK-HA-PGRN
Plasmid#234872PurposeLentiviral plasmid expressing HA-tagged human progranulin.DepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-HA-mCherry-pA
Plasmid#233030PurposeTo Express HA tagged DjCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInsertDjCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.5Syn-CasRX-mCherry-pA
Plasmid#192489PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.4CaMKIIa-CasRX-mCherry-pA
Plasmid#192490PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.4CaMKIIaAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only