We narrowed to 3,154 results for: FRI
-
Plasmid#217428PurposeLentiviral overexpression of human DHFRDepositorInsertDHFR (DHFR Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert sequence is a codon-optimized gBLOCK (IDT)PromoterCMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_3
Plasmid#217434PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 3 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
TH1534-DuET
Plasmid#213246PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1533-DuET
Plasmid#213245PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1532-DuET
Plasmid#213244PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mitoX4-FKBP-HA
Plasmid#185658PurposeMitochondrial targetted (Cox8) FKBP protein with C-terminal HA epitopeDepositorInsertmito-FKBP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-KAT14-547-782
Plasmid#118376PurposeGateway compatible donor vector with KAT14-547-782 truncation.DepositorAvailable SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRAV29
Plasmid#123401Purposeconstruction of TCRDepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only