We narrowed to 8,394 results for: Dos;
-
Plasmid#63440PurposeEncodes RVD positions 10-12 in TALEN assemblyDepositorInsertHD NG NN
UseTALENMutationnoneAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pSMP-NR2F1_1
Plasmid#36362DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB6 Cterminal tail
Plasmid#60403PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta5 tubulin Cterminal tail (TUBB6) using a GAL promoterDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceMay 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4DdeltaC
Plasmid#51607Purposeexpresses myc-tagged Sema4D lacking C terminus in lentiviral backboneDepositorInsertSema4DdeltaC (Sema4d Mouse)
UseLentiviralTagsmyc tagExpressionMammalianMutationdeleted last 70 amino acids in the C-terminusPromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239419PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP857_α-syn:oScarlet KI donor
Plasmid#239403PurposeAAV vector for SpCas9-mediated CRISPR KI of oScarlet at the C-terminus of mouse α-synDepositorInsertoScarlet
UseAAV and CRISPRTagsoScarletExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-Pmyc
Plasmid#157874PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-Pmyc-ccw
Plasmid#158027PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc
Plasmid#158028PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-ccw
Plasmid#158029PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB
Plasmid#236763PurposeA piggybac-based cloning vector containing mouse U6 promoter-driven sgRNA for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB
Plasmid#236764PurposeA piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, human U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA FLAG p85beta
Plasmid#237336Purposetransient overexpression in mammalian cellsDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8
Plasmid#224208PurposeExpresses human KDAC8 (HDAC8) in E. coliDepositorAvailable SinceDec. 6, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-myc-GFP-TNRC6A-SD-WT
Plasmid#215897PurposeExpression of TNRC6A-silencing domain (SD)DepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-CIM1-WT
Plasmid#215898PurposeExpression of TNRC6A-CIM1 domainDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only