We narrowed to 9,353 results for: UTY
-
Plasmid#213276PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR21 (GPR21 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR27-DuET
Plasmid#213278PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR27 (GPR27 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR173-DuET
Plasmid#213270PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR173 (GPR173 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR183-DuET
Plasmid#213273PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR183 (GPR183 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR143-DuET
Plasmid#213264PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR143 (GPR143 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR114-DuET
Plasmid#213258PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR114 (ADGRG5 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR119-DuET
Plasmid#213259PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR119 (GPR119 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GNRHR-DuET
Plasmid#213254PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGNRHR (GNRHR Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
F2RL3-DuET
Plasmid#213237PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertF2RL3 (F2RL3 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FFA2-DuET
Plasmid#213238PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertFFA2 (FFAR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
F2RL1-DuET
Plasmid#213235PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertF2RL1 (F2RL1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
F2RL2-DuET
Plasmid#213236PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertF2RL2 (F2RL2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD97-DuET
Plasmid#213206PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCD97 (ADGRE5 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCRL2-DuET
Plasmid#213205PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCRL2 (CCRL2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
C5A-DuET
Plasmid#213192PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertC5A (C5AR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCKAR-DuET
Plasmid#213195PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCKAR (CCKAR Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCKBR-DuET
Plasmid#213196PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCKBR (CCKBR Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AVPR1B-DuET
Plasmid#213187PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertAVPR1B (AVPR1B Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AVPR2-DuET
Plasmid#213188PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertAVPR2 (AVPR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRA2C-DuET
Plasmid#213179PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertADRA2C (ADRA2C Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorInsertSRRD (SRRD Human)
UseLentiviralTagsV5-APEX2ExpressionMutationPromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pCas-Cas12m-ΔZF
Plasmid#192276PurposeEncodes MmCas12m ΔZF (H549A, C552A) under a constitutive promoterDepositorInsertCas12m ΔZF
UseCRISPRTagsExpressionBacterialMutationH459A, C552APromoterPJ23108Available sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m-ΔZF
Plasmid#192277PurposepCas-dCas12m-ΔZF (D485A, H549A, C552A) under a constitutive promoterDepositorInsertMmdCas12m ΔZF
UseCRISPRTagsExpressionBacterialMutationD485A, H549A, C552APromoterPJ23108Available sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
UseTagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-ε
Plasmid#197261PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 ε fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-4 ε (AP4E1 Human)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationsilent substitutions in codons 905, 1129 and 1137PromoterADH1Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT_phoA-lacZalpha
Plasmid#192961PurposeTest the biological function of the spTse5-CT (1169-1317)-PhoA (22-474)-LacZ (4-60) fusion protein in P. putidaDepositorInsertsptse5-CT_phoA-lacZ_
UseTagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317) fused to phoA-lacZal…PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-2
Plasmid#193693PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-383)-GFP-SSPB(micro)
Plasmid#174627PurposeConstitutively active KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-383)-GFP-SSPB(micro) (Kif1a Synthetic, Mouse)
UseTagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-383): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
H2A-mTurquoise-CDC42-G12V-deltaCAAX
Plasmid#176094PurposeConstitutively active, nuclear localized Cdc42DepositorInsertCDC42 (CDC42 Human)
UseTagsExpressionMammalianMutationG12VPromoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2-VP64:Tnos (GB1395)
Plasmid#160609PurposeTU for the constitutive expresion of the viral coat protein MS2 fused on C-terminal with the VP64DepositorInsertP35S:MS2-VP64:Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniABEMax V82G nSaCas9
Plasmid#135365PurposeExpression of SaCas9 nickase (D10A) with single evolved TadA monomer (ABEMax) with a V82G substitutionDepositorInsertminiABEMax V82G nSaCas9
UseCRISPRTagsExpressionMammalianMutation(V82G)PromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (G112P)
Plasmid#135496PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (G112P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationG112PPromoterCMVAvailable sinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (L156P)
Plasmid#135497PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (L156P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationL156PPromoterCMVAvailable sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-H2-Dd-VN (Y84C/C121S/A139C)
Plasmid#135501PurposeMammalian expression of VN-fused and myc-tagged H2-Dd (Y84C/C121S/A139C mutant)DepositorInsertH2-Dd (H2-D1 Mouse)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84C/C121S/A139CPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (I52P)
Plasmid#135486PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (I52P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationI52PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y59P)
Plasmid#135492PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y59P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY59PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (D61P)
Plasmid#135493PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (D61P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationD61PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (V67P)
Plasmid#135494PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (V67P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationV67PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y84P)
Plasmid#135495PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y84P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (E166P)
Plasmid#135498PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (E166P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationE166PPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (R511C)-V5 blast
Plasmid#83104PurposeLentiviral vector for constitutive expression of human mutant PC5A (R511C) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Arginine 511 to CysteinePromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5-V5 blast
Plasmid#83100PurposeLentiviral vector for constitutive expression of human PC5A (PCSK5) with C-terminal tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (T288P)-V5 blast
Plasmid#83101PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlinePromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (A270T)-V5 blast
Plasmid#83102PurposeLentiviral vector for constitutive expression of human mutant PC5A (A270T) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Alanine 270 to ThreoninePromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (H516P)-V5 blast
Plasmid#83103PurposeLentiviral vector for constitutive expression of human mutant PC5A (H516P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Histidine 516 to ProlinePromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only