We narrowed to 10,106 results for: UTY
-
Plasmid#222896PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFKBP-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2374-FRB-GPA-20-11S
Plasmid#222895PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2373-FRB-GPA-20-114
Plasmid#222894PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2179-FRB-GPA-6-GFPS
Plasmid#222893PurposeBiosensor chain detecting rapamycin and responding with split GFP reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 6 GS linker, split GFP fragment small.DepositorInsertFRB-GPA-6GS-GFPS
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2110-FKBP-GPA-20-114
Plasmid#222881PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFKBP-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2108-FRB-GPA-20-114
Plasmid#222879PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2109-FRB-GPA-20-11S
Plasmid#222880PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MRGPRX4-DuET
Plasmid#213347PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MRGPRX2-DuET
Plasmid#213345PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
NPFF2-DuET
Plasmid#213352PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
NMUR2-DuET
Plasmid#213350PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
NPBW2-DuET
Plasmid#213351PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PK1-DuET
Plasmid#213366PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRRP-DuET
Plasmid#213367PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTAFR-DuET
Plasmid#213368PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
QRFP-DuET
Plasmid#213372PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
P2RY8-DuET
Plasmid#213365PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
NPS-DuET
Plasmid#213353PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
MRGPRG-DuET
Plasmid#213343PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR5-DuET
Plasmid#213380PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SUCNR1-DuET
Plasmid#213381PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
S1PR4-DuET
Plasmid#213375PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR1-DuET
Plasmid#213376PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTGER1-DuET
Plasmid#213370PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(63)-mCherry-FLAG
Plasmid#212809PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(63)-mCherry-FLAG in mammalian cellsDepositorInsertE3(63)
TagsNUbo and mCherry-FLAGExpressionMammalianAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-P2A-3xFLAG-Ubc7
Plasmid#212804PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-P2A-3xFLAG-Ubc7 in mammalian cellsDepositorInsertNUbo-E3(48)-P2A-3xFLAG-Ubc7
ExpressionMammalianAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-mCherry-FLAG
Plasmid#212803PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-mCherry-FLAG in mammalian cellsDepositorInsertE3(48)
TagsNUbo and mCherry-FLAGExpressionMammalianAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Myc-E3(1) C885A-CUbo
Plasmid#212800PurposeConstitutive/Doxycycline-inducible expression of Myc-E3(1) C885A-CUbo in mammalian cellsDepositorInsertE3(1)
TagsCUbo and MycExpressionMammalianMutationHOIP(C885A)Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-His8-H2B-CUbo(K63R)
Plasmid#212814PurposeConstitutive or doxycycline-inducible expression of His8-H2B-CUbo(K63R) in mammalian cellsDepositorInsertH2B
Tags8xHis and CUbo(K63R)ExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-mCherry-FLAG
Plasmid#212798PurposeConstitutive/Doxycycline-inducible expression of NUbo-mCherry-FLAG in mammalian cellsDepositorInsertNUbo
TagsmCherry-FLAGExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212759PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212758PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-NLS-VSV
Plasmid#212755PurposeConstitutive expression of NUbo-E3(63)-NLS-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212749PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212748PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-NLS-VSV
Plasmid#212745PurposeConstitutive expression of NUbo-E3(48)-NLS-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212740PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212739PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-NLS-VSV
Plasmid#212737PurposeConsitutive expression of myc-E3(1)-CUbo-NLS-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1)-CUbo-VSV
Plasmid#212736PurposeConsitutive expression of myc-E3(1)-CUbo-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-VSV
Plasmid#212735PurposeConsitutive expression of myc-E3(1)-CUbo-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-CUbo-mCherry-VSV
Plasmid#212734PurposeConsitutive expression of CUbo-mCherry-VSV in budding yeastDepositorInsertCUbo
UseIntegrative vectorTagsmCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-mCherry-VSV
Plasmid#212731PurposeConsitutive expression of NUbo-mCherry-VSV in budding yeastDepositorInsertNUbo
UseIntegrative vectorTagsmCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-H2B-His8
Plasmid#212810PurposeConstitutive or doxycycline-inducible expression of NUbo-H2B-His8 in mammalian cellsDepositorInsertH2B
Tags8xHis and NUboExpressionMammalianAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-His6-NUbo-H2B-His8
Plasmid#212811PurposeConstitutive or doxycycline-inducible expression of His6-NUbo-H2B-His8 in mammalian cellsDepositorInsertH2B
Tags6xHis-NUbo and 8xHisExpressionMammalianAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only