We narrowed to 20,082 results for: ATO
-
Plasmid#160770PurposeSuppress CDC25CDepositorInsertshCDC25C_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B CDC25C_1
Plasmid#160769PurposeSuppress CDC25CDepositorInsertshCDC25C_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B CDC25A_1
Plasmid#160767PurposeSuppress CDC25ADepositorInsertshCDC25A_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pMCh-1498
Plasmid#82427PurposePlasmid for expression of NHA-tagged Nematostella vectensis GW182 11W11A in mammalian cellsDepositorInsertnvGW182 11W11A
TagsNHAExpressionMammalianMutationTrp 1167, 1183, 1227, 1309, 1391, 1453, 1574, 158…PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1539
Plasmid#82432PurposePlasmid for expression of GST-tagged human-Nematostella GW182 chimera in mammalian cellsDepositorInserths-nvGW182 chimera
TagsGSTExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterEF1AAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1537
Plasmid#82430PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 chimera in mammalian cellsDepositorInserths-nvGW182 chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
C0062 (luxR)_CD
Plasmid#66028PurposeMoClo Basic Part: CDS - Controller protein, luxR repressor/activator (in concert with HSL, represses pLuxR(pR) R0063. Also up-regulates pLuxR(pL) R0062) [C:C0062:D]DepositorInsertTranscription factor
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
SRAcode_in_pUC57_v3(419-999)
Plasmid#49824Purposefor transcribing SRA nucl 419-999 of NM_001035235 with T7DepositorInsertsteroid receptor RNA activator RNA coding (SRA1 Human)
ExpressionBacterialMutationKpnI site at 5' start of RNA coding seqPromoterT7Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
SRAcode_in_pUC57_v3(767-999)
Plasmid#49825Purposefor transcribing SRA nucl 767-999 of NM_001035235 with T7DepositorInsertsteroid receptor RNA activator RNA coding (SRA1 Human)
ExpressionBacterialMutationKpnI site at 5' start of RNA coding seqPromoterT7Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
SRAcode_in_pUC57_v3(419-771)
Plasmid#49823Purposefor transcribing SRA nucl 419-771 of NM_001035235 with T7DepositorInsertsteroid receptor RNA activator RNA coding (SRA1 Human)
ExpressionBacterialMutationKpnI site at 5' start of RNA coding seqPromoterT7Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only