We narrowed to 9,861 results for: CAG
-
Plasmid#108790PurposeExpresses aa234 to C-terminus of PhiC31 integrase fused to FKBP CIDDepositorInsertPhiC31 integrase fragment aa234 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW1345_pCAG-PV1-PhiC31-N396-L1-FRB-NLS-BGHpA
Plasmid#108791PurposeExpresses N-terminus to aa396 of PhiC31 integrase fused to FRB CIDDepositorInsertPhiC31 integrase fragment N-terminus to aa396
UseCre/Lox and Synthetic BiologyTagsFRB,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW1358_pCAG-PV1-FKBP-L1-PhiC31-397C-NLS-BGHpA
Plasmid#108792PurposeExpresses aa397 to C-terminus of PhiC31 integrase fused to FKBP CIDDepositorInsertPhiC31 integrase fragment aa397 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2278_pCAG-PV1-FlpO-N168-L1-ABI-NLS-BGHpA
Plasmid#108765PurposeExpresses N-terminus to aa168 of Flp recombinase fused to ABI CIDDepositorInsertFlp recombinase fragment N-terminus to aa168
UseCre/Lox and Synthetic BiologyTagsABI,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2279_pCAG-PV1-PYL-L1-FlpO-169C-NLS-BGHpA
Plasmid#108766PurposeExpresses aa169 to C-terminus of Flp recombinase fused to PYL CIDDepositorInsertFlp recombinase fragment aa169 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2542_pCAG-PV1-VCre-N172-L1-GID1-NLS-BGHpA
Plasmid#108771PurposeExpresses N-terminus to aa172 of VCre recombinase fused to GID1 CIDDepositorInsertVCre recombinase fragment N-terminus to aa172
UseCre/Lox and Synthetic BiologyTagsGID1,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2562_pCAG-PV1-GAI-L1-VCre-173C-NLS-BGHpA
Plasmid#108772PurposeExpresses aa173 to C-terminus of VCre recombinase fused to GAI CIDDepositorInsertVCre recombinase fragment aa173 to C-terminus
UseCre/Lox and Synthetic BiologyTagsGAI and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2164_pCAG-PV1-FlpO-N168-L1-GID1-NLS-BGHpA
Plasmid#108749PurposeExpresses N-terminus to aa168 of Flp recombinase fused to GID1 CIDDepositorInsertFlp recombinase fragment N-terminus to aa168
UseCre/Lox and Synthetic BiologyTagsGID1,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2184_pCAG-PV1-GAI-L1-FlpO-169C-NLS-BGHpA
Plasmid#108750PurposeExpresses aa169 to C-terminus of Flp recombinase fused to GAI CIDDepositorInsertFlp recombinase fragment aa169 to C-terminus
UseCre/Lox and Synthetic BiologyTagsGAI and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2210_pCAG-PV1-iCre-N251-L1-GID1-NLS-BGHpA
Plasmid#108725PurposeExpresses N-terminus to aa251 of Cre recombinase fused to GID1 CIDDepositorInsertCre recombinase fragment N-terminus to aa251
UseCre/Lox and Synthetic BiologyTagsGID1,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2211_pCAG-PV1-iCre-N256-L1-GID1-NLS-BGHpA
Plasmid#108727PurposeExpresses N-terminus to aa256 of Cre recombinase fused to GID1 CIDDepositorInsertCre recombinase fragment N-terminus to aa256
UseCre/Lox and Synthetic BiologyTagsGID1,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2231_pCAG-PV1-GAI-L1-iCre-257C-NLS-BGHpA
Plasmid#108728PurposeExpresses aa257 to C-terminus of Cre recombinase fused to GAI CIDDepositorInsertCre recombinase fragment aa257 to C-terminus
UseCre/Lox and Synthetic BiologyTagsGAI and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2610_pCAG-PV1-FKBP-L1-iCre-257C-NLS-BGHpA
Plasmid#108736PurposeExpresses aa257 to C-terminus of Cre recombinase fused to FKBP CIDDepositorInsertCre recombinase fragment aa257 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW811_pCAG-PV8-F14-GFP-T2A-mCherry-BGHpA
Plasmid#87587PurposePV8 for 3-input, 2-output Full AdderDepositorInsertEGFP, mCherry
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable sinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE mEos3.2-Camk2a KI
Plasmid#131493PurposeEndogenous tagging of CaMKIIa: N-terminal (amino acid position: before startcodon)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMV-VARNAM
Plasmid#115552PurposeRed fluorescent voltage indicator for mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVARNAM
TagsGolgi and ER export signalExpressionMammalianPromoterCMV IE94Available sinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting AAVS1 (AAVS1 Synthetic)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miABE
Plasmid#205412PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6-_RNA*-pCAG-bpNLS-TadA8e(V106W)-32aa-OgeuIscB*(D61A)-GS-bpNLS-GS-TadA8e(V106W)-bpNLS-bGH polyA-pCMV-mCherry-AmpR
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eMagB-iRFP-Mito
Plasmid#162250PurposeBlue-light dependent heterodimerization systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteMagB-iRFP-OMP25
ExpressionMammalianPromoterbeta-actin promoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by