We narrowed to 5,149 results for: mag
-
Plasmid#65053PurposeReporter plasmid to detect miR148/152 family expressionDepositorInsertEngineered target sites miR-148a-3p (MIR148A Mouse, Human)
UseLuciferaseExpressionMammalianPromoterSV40Available SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL Hygro-NFLAG TRF1 deltaM
Plasmid#16281DepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsFlagExpressionMammalianMutationDeleted myb domain (aa379-439)Available SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS10
Plasmid#113956Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, S212N substitution…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II tension sensor (FL-based)
Plasmid#118721PurposeThe FL-based human desmoplakin II tension sensor detects forces in the range of 3-5 pN by changes in FRET between YPet(short) and mCherry.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherryExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II no force control (F40-based)
Plasmid#118716PurposeThe no force control for the F40-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH3-1
Plasmid#105859PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH3.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH3 derived…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH2-1
Plasmid#105857PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH2 derived…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO0.9
Plasmid#61249PurposeExpresses REX-GECO0.9 in neuronsDepositorInsertREX-GECO0.9
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL Hygro-NFLAG TRF1 deltaA deltaM
Plasmid#16297DepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsFlagExpressionMammalianMutationDeleted acidic domain (aa1-66) and myb domain (aa…Available SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
ECMAB - pET22b Ag43 160N 6H Mms6
Plasmid#225539PurposeConstruction of extracellular magnetite accumulating bacterial systems.DepositorInsertsIron binding protein
Autotransporter protein
TagsnoExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP5299 ss-FIREmate-HA- KDEL-IVS-IRES- ManII-SBP- mApple-FIREtag
Plasmid#216695PurposeSynchronize anterograde and retrograde trafficking of ManII between ER and Golgi (RUCH system)DepositorInsertsTagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.IgK-NGR
Plasmid#196226PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ash-mKate2-splitmVenusN
Plasmid#69582PurposeExpresses p53 tagged with mKate2 and split N-term mVenusDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH1h-1
Plasmid#105856PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH1 and hin…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2-3
Plasmid#105851PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH2 derived…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344P-mKate2-splitmVenusC
Plasmid#69587PurposeExpresses mutated p53-L344P tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH1h-3
Plasmid#105850PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH1 and hin…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLK06Hpp-Fab CR3009
Plasmid#239861PurposePlasmid for simultaneous Fab and GFP expression from separate Lac promoters for online monitoring of induction with a GFP sensor station. Fab is expressed as a fusion with alkaline phosphatase.DepositorInsertsTagsHexahistidine tag and bacterial alkaline phosphat…ExpressionBacterialMutationF64L, S65T, Q80R, M153T and V163APromoterLac promoterAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH002_phiC31_neo-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179430PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only