We narrowed to 3,543 results for: pir
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro_Q306A-HIS
Plasmid#224697PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro active protease with His-tagDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21b(+)_SARS-CoV-2_3CLpro_C145A-HIS
Plasmid#224698PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro inactive protease with His-tagDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits