We narrowed to 39,968 results for: lat
-
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only
-
PPIB-bio-His
Plasmid#53413PurposeExpresses full-length Peptidyl-prolyl cis-trans isomerase B precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPPIB (PPIB Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK340
Plasmid#192639PurposeExpresses dSpG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dSpG has se…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
R702-X31-566: His6-MBP-tev-G-Hs.PDE6D(2-150)
Plasmid#159689PurposeE. coli protein expression of His6-MBP-tev-G-Hs.PDE6D(2-150)DepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk12_Untagged
Plasmid#127176PurposeUntagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into Gateway entry vectorDepositorInsertMouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UseEntry vector with transgene for gateway cloningTagsNonePromoterNoneAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV 5TOP intron renilla TRICK CTE polyA
Plasmid#64544Purpose5′ TOP TRICK reporter mRNADepositorInsert12x PP7 stem-loops
Tags24xMS2 stem loops, 5' TOP (5′ terminal oligo…ExpressionMammalianPromoterTetracycline-inducible promoter and 5′ UTR of hum…Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-Intron-CterFlag-MePCE
Plasmid#113549PurposeMammalian expression plasmid that can be used with the Flp-In T-REx system.DepositorAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MCS-eDHFR(69K6)-EGFP
Plasmid#172101PurposeMammalian expression of a protein of interest fused to the N-terminus of eDHFR(69K6)-EGFPDepositorInsert22aa-eDHFR(69K6)-EGFP
ExpressionMammalianMutationeDHFR(69K6): Hexalysine (K6) sequence is inserted…PromoterCMVAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH732-2µ-RLuc/staCFLuc
Plasmid#40607DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTET2-lucCP-3MS2
Plasmid#198351PurposePart of Firefly reporter system, encodes Firefly luciferase with MS2 stem loops in the 3'UTRDepositorInsertFirefly Luciferase
UseLuciferaseExpressionMammalianPromoterpTET2Available SinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2/NS5-YFP-NLS-mut
Plasmid#120832PurposeEctopic expression of ZIKV proteinDepositorInsertZIKV NS5-eYFP "NLS-mut"
TagseYFP-V5ExpressionMammalianMutationR372A/Q373A/K387A/H388A/K389APromoterCMVAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
VP-ARF
Plasmid#89122Purposemammalian expression of p14-hARF linked to VP16 activation domainDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)- e18 LOF
Plasmid#131729PurposeExpresses a loss of function mutant of an engineered variant of RAD18 ("e18")DepositorInserte18/D221A (Loss of function mutant of RAD18 with SAP domain deleted and UBZ point mutation) (RAD18 Human)
TagsFLAG and HAExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX neo PFKP-GFP K281R
Plasmid#138288PurposeMammalian Expression, Lentiviral. Expression of human phosphofructokinase platelet isoform PFKP-GFP fusion protein with K281R mutationDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR KIF17 (1-738)
Plasmid#60406PurposeExpression of truncated form of human homodimeric kinesin-2 (KIF17) amino acids 1-738DepositorInsertKIF17 (KIF17 Human)
UseLentiviralTagsGB1, Strep-Tag, and sfGFPExpressionMammalianMutationTruncated version amino acids 1-738PromoterSFFVAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-mCherry
Plasmid#65283PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
UseLentiviralTagsStreptavidin Binding Protein (SBP) and mCherryPromoterCMVAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP11 CS puroR
Plasmid#46748PurposeRetroviral vector that expresses catalytically inactive form of Flag-tagged human USP11DepositorInsertUSP11 (USP11 Human)
UseRetroviralTagsFlagExpressionMammalianMutationC318S--catalytically inactivePromoterCMVAvailable SinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only