We narrowed to 276 results for: aav vectors expressing gfp
-
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGH
Plasmid#74289PurposepAAV vector to express H2B-GFP and oG (optimized Glycoprotein) in a Cre-dependent mannerDepositorInsertH2B-GFP and oG (optimized Glycoprotein)
UseAAVExpressionMammalianMutationchimeric glycoproteinPromoterEf1aAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CTG uGIP polyGly (exon 4 Cter) GFP (OPDM type 2)
Plasmid#250410PurposeGFP-tagged polyglycine protein expressed from an upstream small ORF of GIPC1. This vectors uses 100 GGN optimized codons. Translation is driven by a CTG near cognate start codon.DepositorInsertuGIPpolyG
UseAAVTagsGFPExpressionMammalianAvailable SinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAVS1-Neo-CAG-M2rtTA-H2BGFP (donor AB)
Plasmid#85798PurposedonorAB targeting vector for human AAVS1 locus; knock-in of Dox controlled H2BGFP expression systemDepositorInsertPPP1R12C (PPP1R12C Human)
UseHuman targetingMutationhomology arms for knock-in into first intronAvailable SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only