We narrowed to 6,915 results for: tac
-
Plasmid#118376PurposeGateway compatible donor vector with KAT14-547-782 truncation.DepositorAvailable SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLAP-BUBR1-3A
Plasmid#114054Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertBUBR1-3A (BUB1B Human)
TagsYFP-TEV-S- Human LAPExpressionMammalianMutationC2823A and G2826A (siRNA-resistance), BUBR1-S670A…Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLAP-BUBR1-3D
Plasmid#114055Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertBUBR1-3D (BUB1B Human)
TagsYFP-TEV-S- Human LAPExpressionMammalianMutationC2823A and G2826A (siRNA-resistance), BUBR1-S670D…Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-KAT14-1-546
Plasmid#118377PurposeGateway compatible donor vector with KAT14-1-546 truncation.DepositorAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLAP-MIS12-KARD-3D
Plasmid#114058Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertMIS12-KARD-3D (BUB1B Human)
TagsYFP-TEV-S- Human LAPExpressionMammalianMutationBUBR1-S670D, S676D and T680DAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLAP-MIS12-KARD-3A
Plasmid#114059Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertMIS12-KARD-3A (BUB1B Human)
TagsYFP-TEV-S- Human LAPExpressionMammalianMutationBUBR1-S670A, S676A and T680AAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN260
Plasmid#91581PurposeExpress sgRNA targeting human CLUDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-2B-Nkx2-5YRD Y-A
Plasmid#98611PurposeGateway entry vector for NKX2-5 YRD Y-ADepositorInsertNKX2-5 YRD Y-A (Nkx2-5 Mouse)
UseEntry vectorMutationSubstitutions of 7 tyr into Ala residues.Y233A; Y…Available SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh1
Plasmid#92033PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #1 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PFKP gRNA (BRDN0001146136)
Plasmid#77626Purpose3rd generation lentiviral gRNA plasmid targeting human PFKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TPK1 gRNA (BRDN0001148561)
Plasmid#77430Purpose3rd generation lentiviral gRNA plasmid targeting human TPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK494 gRNA (BRDN0001145451)
Plasmid#77172Purpose3rd generation lentiviral gRNA plasmid targeting human SGK494DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3R1 gRNA (BRDN0001145056)
Plasmid#77091Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3R1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3R1 gRNA (BRDN0001148578)
Plasmid#77092Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3R1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK24 gRNA (BRDN0001146213)
Plasmid#77057Purpose3rd generation lentiviral gRNA plasmid targeting human STK24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK3 gRNA (BRDN0001149287)
Plasmid#76735Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK3 gRNA (BRDN0001147858)
Plasmid#76181Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STRADA gRNA (BRDN0001145392)
Plasmid#76055Purpose3rd generation lentiviral gRNA plasmid targeting human STRADADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only