We narrowed to 8,749 results for: Dos
-
Plasmid#253676PurposeExpresses C-Flag/HA HPV101 E7 in lentiviral backgroundDepositorInsertHPV101 E7
UseLentiviralTagsFlag/HAExpressionMammalianPromoterCMVAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
CT7-LOVHook-Zdk-Sca-GPI
Plasmid#246602PurposeExpresses RudLOV Hook and cargo(GPI) in mammalian cells.DepositorAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
CMV-Zdk-Sca-GPI
Plasmid#246609PurposeExpresses RudLOV cargo(GPI) in mammalian cells.DepositorAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-Pmyc
Plasmid#157874PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-Pmyc-ccw
Plasmid#158027PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc
Plasmid#158028PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-ccw
Plasmid#158029PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB
Plasmid#236763PurposeA piggybac-based cloning vector containing mouse U6 promoter-driven sgRNA for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB
Plasmid#236764PurposeA piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, human U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA FLAG p85beta
Plasmid#237336Purposetransient overexpression in mammalian cellsDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-WT
Plasmid#215897PurposeExpression of TNRC6A-silencing domain (SD)DepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-CIM1-WT
Plasmid#215898PurposeExpression of TNRC6A-CIM1 domainDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-GFP-TNRC6A-SD-CIM2-WT
Plasmid#215899PurposeExpression of TNRC6A-CIM2 domainDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.KIF13A
Plasmid#224408PurposeMammalian expression of Kif 13aDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S SARS-CoV-2 virus, Budding Yeast)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only