We narrowed to 7,539 results for: Cit
-
Plasmid#215614PurposeFor integration of CEBPa AroLITE mEGFPDepositorAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGAL4-DBD-NGN2-WT
Plasmid#215607PurposeFor overexpression of Gal4-DBD NGN2 WTDepositorInsertNGN2 (NEUROG2 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXC4-AroPERFECT
Plasmid#215588PurposeFor overexpression of Gal4-DBD HOXC4 AroPERFECTDepositorInsertHOXC4 AroPERFECT (HOXC4 Human)
ExpressionMammalianAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXC4-AroLITE_S
Plasmid#215587PurposeFor overexpression of Gal4-DBD HOXC4 AroLITE SDepositorInsertHOXC4 AroLITE S (HOXC4 Human)
ExpressionMammalianAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-NANOG-AroLITE_A
Plasmid#215600PurposeFor overexpression of Gal4-DBD NANOG AroLITE ADepositorInsertNANOG AroLITE A (NANOG Human)
ExpressionMammalianAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mEGFP-hCEBPa_AroPERFECT_IS15
Plasmid#215615PurposeFor integration of CEBPa AroPERFECT IS15 mEGFPDepositorAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mEGFP-hCEBPa_AroPERFECT_IS10
Plasmid#215616PurposeFor integration of CEBPa AroPERFECT IS10 mEGFPDepositorAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mEGFP-hCEBPa_WT
Plasmid#215613PurposeFor integration of CEBPa WT mEGFPDepositorAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsNot9-V181E-shRNA2res_AG
Plasmid#148829PurposeMammalian Expression of HsNot9-V181E-shRNA2resDepositorInsertHsNot9-V181E-shRNA2res (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-HsNot10_25-707-HsNot11_257-498-CvH_AF
Plasmid#148731PurposeBacterial Expression of HsNot10_25-707-HsNot11_257-498DepositorInsertHsNot10_25-707-HsNot11_257-498 (CNOT10 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj1b-IRES-EGFP
Plasmid#164946PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj1b and EGFPDepositorInsertkcnj1b (kcnj1b Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2-VP64:Tnos (GB1395)
Plasmid#160609PurposeTU for the constitutive expresion of the viral coat protein MS2 fused on C-terminal with the VP64DepositorInsertP35S:MS2-VP64:Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
hKCNB1 R312H
Plasmid#124488Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vectorDepositorInserthuman KCNB1 (KCNB1 Human)
TagsHAExpressionMammalianMutationchanged arginine 312 to histidineAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRAV29
Plasmid#123401Purposeconstruction of TCRDepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
hKCNB1 G379R
Plasmid#124489Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vectorDepositorInserthuman KCNB1 (KCNB1 Human)
TagsHAExpressionMammalianMutationchanged glycine at 379 to arginineAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti C-MYC-DDK Puro PNRC1-W300A
Plasmid#123301PurposeMammalian expression of PNRC1-W300A mutant C-MYC-FLAGDepositorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
DLG3_PDZ_2
Plasmid#103947PurposeProtein expression and purification of NE-DLG PDZ2 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only