We narrowed to 4,088 results for: PRS
-
Plasmid#185087PurposeSwi6L-GFP with nuclear export signal mutated to alaninesDepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 nuclear export signal L to A mutationsPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB394
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
UseTagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAPromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
UseTagsGFPExpressionYeastMutationRfa2 truncation aa 1-247PromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB353
Plasmid#185081PurposeSwi6M-GFP expressing N-term 181 amino acids of Swi6DepositorInsertSWI6
UseTagsGFPExpressionYeastMutationSwi6 truncation aa 1-181PromoterAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB484
Plasmid#185132PurposeSWI6-GFP full length under control of GAL1 promotionDepositorInsertSWI6
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-197
Plasmid#169924PurposeWT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2DepositorInsertEcm2 1-197
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBHRSF228
Plasmid#135007PurposeMusF2 prenyltransferases from Nostoc sp. UHCC 0398DepositorInsertMusF2 prenyltransferase
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
UseTagsExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP89b CvTA V124N
Plasmid#141207PurposeChromobacterium violaceum transaminase with enhances affinity for PLP. TEV cleaving site after the N-terminal Histag.DepositorInsertCvTA
UseTagsExpressionBacterialMutationV124NPromoterAvailable sinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet139
Plasmid#121913PurposeCharge-Introduced NpuDnaB mini-inteinDepositorInsertCI-NpuDnaBΔ290 intein
UseTagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet140
Plasmid#121914PurposeOrthogonal NpuDnaB mini-intein inteinDepositorInsertOth-NpuDnaBΔ290 intein
UseTagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMET17p-CCG 316
Plasmid#131166PurposeFor ScMET17 promoter regulated expression of mCherry-Cub-R-GFP (CCG) fused bait proteins, centromeric ARS plasmid, URA3 complements the uracil auxotrophy of S. cerevisiae ura mutantDepositorTypeEmpty backboneUseTagsCCGExpressionYeastMutationPromoterAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Spt2-K166R-GFP
Plasmid#115573PurposeExpresses yeast Spt2-GFP fusion protein mutated from lysine to arginine at site 166DepositorInsertSPT2
UseTagsGFPExpressionBacterial and YeastMutationLysine 166 mutated to ArgininePromoterAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X2
Plasmid#115567PurposeGFP tethered to two repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationTwo repeats of the Gcn5 consensus motif are tagge…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X1
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 N4A 3xFLAG
Plasmid#111975PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker. It has 3xFLAG at the C-terminus. Contains the N4A mutation.DepositorInsertHsh155 N4A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationT178A R181A R182A R186APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 K818A 3xFLAG
Plasmid#111982PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has 3xFLAG at the C-terminus. Contains K818A mutation. LethalDepositorInsertHsh155 K818A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationK818APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 R775A 3xFLAG
Plasmid#111977PurposeShuffle plasmid containing the HSH155 gene and surrounding regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has 3xFLAG at the C-terminus. Contains R775A mutation. LethalDepositorInsertHsh155 R775A 3x FLAG
UseTags3xFLAGExpressionBacterial and YeastMutationR775APromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only