We narrowed to 4,353 results for: erf
-
Plasmid#170741PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pST_CAHS3_HYPDU (pBS0333)
Plasmid#185179PurposeFor the mammalian expression of the tardigrade protein CAHS3_HYPDU. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertCAHS3_HYPDU
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_E114I (pBS0839)
Plasmid#185274PurposeFor the mammalian expression of the human protein APOE_HUMAN_E114I. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAPOE_HUMAN_E114I
UseTagsExpressionMammalianMutationE114IPromoterAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFLAG CPTP
Plasmid#170742PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST_AfrLEA3m (pBS0911)
Plasmid#185285PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAfrLEA3m
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k3_26 (pBS0762)
Plasmid#185244PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
UseTagsExpressionBacterial and YeastMutationPromoterAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pST_MAHS_RAMVA (pBS0310)
Plasmid#185169PurposeFor the mammalian expression of the tardigrade protein MAHS_RAMVA. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertMAHS_RAMVA
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_AtCor47 (pBS0784)
Plasmid#185254PurposeFor the mammalian expression of the Arabidopsis protein DHN_AtCor47. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_AtCor47
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf166
Plasmid#12854PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf166
UseTagsExpressionMammalianMutationPromoterAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralTagsExpressionMutationPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialMutationPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
DCT.VV.Orf98
Plasmid#12786PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf98
UseTagsExpressionMammalianMutationPromoterAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -