We narrowed to 4,063 results for: biorxiv
-
Plasmid#234994PurposeFor production of Extracellular Vesicles (EVs), with Epithelial Growth Factor Receptor on their surface, Strep-tag II labeled on its N-terminusDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pHA StreptagII 3C NIS EABR
Plasmid#234988PurposeFor production of Extracellular Vesicles (EVs), with a Strep-tag II labeled Sodium-iodide symporter (NIS), and an HA epitope at its N-terminus on their surfaceDepositorAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-tdiRFP-caax (JDW 1311)
Plasmid#224497PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and tdiRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-tdiRFP-caax
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
5_T7-GAP43-mScarlet3
Plasmid#225932PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the GAP43 membrane localisation signalDepositorInsertGAP43-mScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME Lamin B Vhh mNeonGreen-pA (JDW 1312)
Plasmid#224501PurposeGateway compatible middle entry clone containing Lamin B nanobody fused to mNeonGreen with HA Tag (For visualizing the nuclear lamina, lamin chromobody)DepositorInsertLamin B Vhh mNeonGreen-pA
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-nls-mCherry-stop-IRES-myr-EGFP (JDW 1326)
Plasmid#229812PurposeA CAGGS driven expression vector containing an nls-mCherry followed by an IRES and then a myristoylated EGFP for labeling the cell membrane.DepositorInsertnls-mCherry
TagsSV40 NLSExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCF160_VSV-G
Plasmid#225963PurposeCMV-Intron-VSVG (env protein). Expresses VSV-G env for VLP production.DepositorInsertCMV-Intron-VSVG (env protein)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Sun1-2xsfGFP-6xMYC-pA (JDW 681)
Plasmid#224489PurposeGateway compatible middle entry clone containing Sun1 reporter fusion to 2 copies of sfGFP and 6 MYC tags (Nuclear envelope reporter and affinity tag)DepositorInsertSun1-2xsfGFP-6xMYC-pA
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg2 hp
Plasmid#218094PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
1_T7-mScarlet3-Hras
Plasmid#225928PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the H-Ras membrane localisation signalDepositorInsertmScarlet3-HRas
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME Actin Vhh mNeonGreen-HA-pA (JDW 1248)
Plasmid#224500PurposeGateway compatible middle entry clone containing Actin nanobody fused to mNeonGreen with an HA tag (Visualizing actin, actin chromobody)DepositorInsertActin-Vhh-mNeonGreen-HA-pA
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
2_T7-mScarlet3-KRas
Plasmid#225929PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the K-Ras membrane localisation signalDepositorInsertmScarlet3-KRas
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-hEF1a-mODC-rtTA-IRES-NEO (JDW 1130)
Plasmid#229839PurposeA CAGGS driven, piggybac compatible, tet-on expression vector containing a luciferase reporter followed by a P2A cleavage peptide and H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-MCS-c-Fos-b-globin (JDW 1237)
Plasmid#229829PurposeA gateway compatible 5' entry clone containing an MCS upstream of the murine c-fos minimal promotor and b-globin intron.DepositorInsertc-fos minimal promoter and b-globin intron
UseGateway entry cloneExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only