We narrowed to 1,869 results for: sfGFP
-
-
-
-
-
-
-
pM2s2AsG
Plasmid#137924PurposeE. coli Nissle pMUT2-derived plasmid with ampicillin resistance and constitutive GFP expressionDepositorInsertSuperfolder GFP
UseSynthetic Biology; For use with e. coli nissle in…ExpressionBacterialPromoterJ23101Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2 sfGFP
Plasmid#117123PurposeC-terminal GFP tagDepositorInsertSuperfolder GFP
UseGolden gate donor vector for gene targeting in ba…TagssfGFPAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Hyg
Plasmid#236480PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Hyg.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Nat
Plasmid#236479PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Nat.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pET21b-RL015A
Plasmid#42134DepositorInsertsfGFP-mCherry
ExpressionBacterialPromoterT7 promoterAvailable SinceFeb. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET sfGFP(150TAG)
Plasmid#133455Purposeexpresses sfGFP with an unnatural amino acid at the 150th position in bacterial cellsDepositorInsertsfGFP
TagsHisExpressionBacterialPromoterT7Available SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
sfGFP-ER-3
Plasmid#56482PurposeLocalization: Endoplasmic Reticulum, Excitation: 485, Emission: 507DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRHA12
Plasmid#138942PurposeAND gate with IPTG and aTc as inputs and sfGFP as outputDepositorInsertriboregulated sfGFP
ExpressionBacterialAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-sfGFP
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only