We narrowed to 7,325 results for: 11
-
Plasmid#31451DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only
-
EGFR WT
Plasmid#11011PurposeRetroviral construct for expressing human EGFR in human cellsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
MSCV-XZ066-EGFRvIII
Plasmid#20737DepositorInsertEGFRvIII (EGFR Human)
UseRetroviralExpressionMammalianMutationEGFR with a 267 amino acid deletion in the extrac…Available SinceMarch 31, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D377Y-mPCSK9
Plasmid#58376PurposeExpresses GoF mutant murine PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (Pcsk9 Mouse)
UseAAVExpressionMammalianMutationD377YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-RFP
Plasmid#1817PurposeMammalian expression of Lamp1 fused to RFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsRFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAL119-TK
Plasmid#21911DepositorInsertHSV Type 1 thymidine kinase
UseAdenoviralAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
SepRS(2)/pSertRNA(B4)/EF-Sep
Plasmid#173897PurposeThe plasmid contains an orthogonal aminoacyl-tRNA synthetase/tRNACUA pair, which directs the efficient incorporation of phosphoserine (pSer) into recombinant proteins in Escherichia coli.DepositorInsertsSepRS(2)
pSertRNA
EF-Sep
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mRuby2
Plasmid#175294PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mRuby2
TagsmRuby2ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEVOL_PylRS(AF)-tRNA
Plasmid#223511PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialMutationY306A; Y384FPromoteraraBAD, rrnB, and glnS and proKAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_neg.cont
Plasmid#99315PurposeNegative control for luciferase validation vectorsDepositorInsertneutral region; chr3: 55198740-55200041
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEVOL_PylRS(WT)-tRNA
Plasmid#223512PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialPromoteraraBAD, rrnB, and glnS and proKAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-N2-Frankenbody-HA
Plasmid#175292PurposeVisualize endogeneous loci coupled with ZF probes harboring 10xHA tagDepositorInsertanti-HA frankenbody fused with mCherry
TagsmCherryExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ECFP
Plasmid#112220PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and ECFPDepositorInsertECFP
UseCRISPRExpressionMammalianAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-SNAP
Plasmid#175295PurposeTrack mature FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with SNAP-tag
TagsSNAP-tagExpressionMammalianAvailable SinceOct. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-GRAB_eCB2.0
Plasmid#164604PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only