We narrowed to 28,296 results for: cmv promoter
-
Plasmid#101635PurposeEncodes the fluorescent protein Rosmarinus under a CMV promoter.DepositorInsertRosmarinus
ExpressionMammalianPromoterCMVAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
EW489 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-(GGS)x8[G2V G4W S6L G7L G10W G11D G13L G17M G19I G22M G23Q S24Q]-FKBP (FLP-IN)
Plasmid#236147PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to FKBP1A, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-FKBP
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-NNG-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249079PurposeExpresses nucleus-localized NNG-Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertNNG-Slug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-SpG-P2A-EGFP (BKS965)
Plasmid#242652PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpG(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpG-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, SpG mutations in SpCas9…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CABE-T1.17
Plasmid#193260PurposeExpression of CABE-T1.17 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T1.17
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CABE-T2.9
Plasmid#193264PurposeExpression of CABE-T2.9 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T2.9
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD1029 ZF43x6-Compact(CMVMin)_EYFP
Plasmid#138913PurposeEYFP reporter vector for the ZF43x6-Compact(overlapping ZF37) promoter with a CMV minimal promoterDepositorInsertZF43x6-Compact(CMVmin)
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-Compact(CMVmin)Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
AcrIIA5-E76-LOV-C450A-K488N(M478)
Plasmid#250778PurposeExpresses AcrIIA5-E76-AsLOV2 with C450A and K488N mutation from a CMV promoter. For use in mammalian cellsDepositorInsertAcrIIA5 with an AsLOV2 insertion behind E76 and C450A and K488N mutation
UseCRISPRExpressionMammalianMutationC450A, K488NAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHCFnc/V5
Plasmid#247003PurposeExpresses non cleavable HCF-1 with carboxy terminal V5 tag under control of the CMV promoterDepositorInsertHCF-1 (HCFC1 Human)
TagsV5 tagExpressionMammalianMutationGlu to Ala change at amino acid positions 1019,10…Available SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-TAZ-CAMTA1
Plasmid#235679PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
JD92
Plasmid#229478PurposeCMV promoter driving expression of adenoviral E4orf6 geneDepositorInsertE4orf6
UseAAV and AdenoviralExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
psglessClonePX
Plasmid#87193Purposeused for downstream cloning, contains CMV promoter with NheI and XhoI cloning sites flanking a partial insert that gets excised when adding an insert of choiceDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only