We narrowed to 162,676 results for: addgene
-
Plasmid#228149PurposePlasmid contains the secretion signal peptide sequence of the human GDF8 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_O14793_GDF8_HUMAN:0-18
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA1-Filler-v1
Plasmid#237399PurposeFor inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v2.DepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterU6, PGKAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA1-Filler-v2
Plasmid#237400PurposeFor inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v1.DepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterU6, PGKAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-mScarlet-SH3PXD2A
Plasmid#215534PurposeExpression vector with Tks5 tagged with N-terminal mScarletDepositorInsertSH3PXD2A (SH3PXD2A Human)
UseTagsmScarletExpressionMammalianMutationPromoterCMVAvailable sinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pINDUCER20-PTPN12
Plasmid#215517PurposeDox-inducible lentiviral transfer vector with PTP-PESTDepositorInsertPTPN12 (PTPN12 Human)
UseLentiviralTagsExpressionMutationPromotermCMV, Doxycycline-inducibleAvailable sinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorInsertMYADM (MYADM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB2188-PrARG8-GFP::URA3
Plasmid#216512PurposeIntegrative fluorescent reporter for amino acid biosynthesis sensing pathways, comprising GFP driven by the ARG8 promoter within the Easy clone vector, requires NotI digestion for integration in yeastDepositorInsertPrARG8-yeGFP
UseCre/Lox; IntegrativeTagsExpressionYeastMutationPromoterARG8Available sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB2197-PrGNP1-mK2-NatMX
Plasmid#216513PurposeIntegrative fluorescent reporter for amino acid uptake sensing pathway, comprising mKate2 driven by the GNP1 promoter within the Easy clone vector, requires NotI digestion for integration in yeastDepositorInsertPrGnp1-mKate2
UseCre/Lox; IntegrativeTagsExpressionYeastMutationPromoterGNP1Available sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Podxl S. pyogenes)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-eBFP2-sgRNA_CTCF_ZF1
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
UseTags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
UseTagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
UseTagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
UseTagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
UseTags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1133
Plasmid#229869PurposeDestination RMCE vector containing FRT::SA::51-bp Artificial exon::3xStop::SL2::SapI Insertion sites (to clone new driver with 3'UTR in slot 5 and SEC in slot 6)::reverse FRT3 to swap driver via RMCEDepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Halo XRCC4
Plasmid#207541PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XRCC4 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human XRCC4 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only