We narrowed to 526 results for: TRIP-1
-
Plasmid#64038PurposeMammalian expression of TTF-1 mutant homeodomain fused to the N-terminal repressor domain of the drosophila engrailed protein (Eng)DepositorInsertTTF-1 (TTF1 dog)
UseTagsEng (N-terminal repressor domain of the drosophi…ExpressionMammalianMutationhomeodomain, aa 154-226, with aa 48–50 replaced b…PromoterCMVAvailable sinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
HH06-LP Clone 6 heavy chain
Plasmid#192176PurposeClone 6 heavy chain (HH06)DepositorInsertClone 6 heavy chain (HH06)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH02-LP Clone 2 heavy chain
Plasmid#192175PurposeClone 2 heavy chain (HH02)DepositorInsertClone 2 heavy chain (HH02)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HK02-LP Clone 2 light chain
Plasmid#192179PurposeClone 2 light chain (HK02)DepositorInsertClone 2 light chain (HK02)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH13 Clone 13 heavy chain
Plasmid#192177PurposeClone 13 heavy chain (HH013)DepositorInsertClone 13 heavy chain (HH013)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH13A Clone 13A heavy chain
Plasmid#192178PurposeClone 13A heavy chain (HH13A)DepositorInsertClone 13A heavy chain (HH13A)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HK13A Clone 13A light chain
Plasmid#192182PurposeClone 13A light chain (HK13A)DepositorInsertClone 13A light chain (HK13A)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:(MCS)-S11-DI-GFP1–9
Plasmid#108260PurposeBinary vectors used for the inducible expression of dual intein-coupled tripartite split-sfGFP components in plantsDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionPlantMutationPromoterUBQ10:sXVE:Available sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-H2B-3xFLAG-2A-G(N2c)
Plasmid#194355PurposeAAV constitutively expressing nuclear FLAG and Rabies Glycoprotein (G) of CVS-N2c strainDepositorInsertsH2B-3xFLAG
Rabies CVS-N2c glycoprotein (G)
UseAAVTagsFLAGExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-2A-G(N2c)-WPRE
Plasmid#194352PurposeLentivirus expressing eGFP and Rabies Glycoprotein (G) from CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
Rabies CVS-N2c glycoprotein (G)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ATG-3xHA-S11
Plasmid#108238PurposeBinary vectors used for the inducible expression of tripartite split-sfGFP components (3xHA-S11 as control) in plantsDepositorInsertATG-3xHA-S11
UseSynthetic BiologyTagsExpressionPlantMutationPromoterUBQ10:sXVE:Available sinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGreenII Tfs-qqr::LUC
Plasmid#44466PurposeExpresses a luciferase gene disrupted by a QQR ZFN target site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by a QQR ZFN target site and a frame-shift mutation
UseLuciferase; Plant transformationTagsExpressionMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable sinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-TVAmCherry-2A-G(N2c)
Plasmid#194354PurposeAAV expressing TVA-mCherry fusion and Rabies Glycoprotein (G) of CVS-N2c strain under neuronal-specific promoterDepositorInsertsTVA-mCherry fusion protein
Rabies CVS-N2c Glycoprotein
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
KSP_K560GFP
Plasmid#129770PurposeExpresses Xenopus Kinesin-5 KSP head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKSP (kif11.L Frog)
UseTagsGFP and His6ExpressionBacterialMutationTruncation at 367, fused to kinesin-1 starting Al…PromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 2 HH06 pFUSE-IgG1-Knob-mutation knob-clone6
Plasmid#192184PurposeClone 16 (HH06) pFUSE-IgG1-Knob-mutation knob-clone6DepositorInsertClone 6 heavy chain (HH06)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGreenII Tfs-494::LUC
Plasmid#44467PurposeExpresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
UseLuciferase; Plant transformationTagsExpressionMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable sinceApril 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 3 HK02 pFUSE-IgG-human kappa VL-CH1 hole-clone2
Plasmid#192185PurposeClone 16 (HK02) pFUSE-IgG-human kappa VL-CH1 hole-clone2DepositorInsertClone 2 light chain (HK02)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-μ1A-(HA)3
Plasmid#198177PurposeExpression of HA-tagged AP-1 μ1A in mammalian cellsDepositorInsertAP-1 μ1A
UseTagstriple HA tagExpressionMammalianMutationPromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only