We narrowed to 676 results for: ADH1;
-
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212759PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212758PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-NLS-VSV
Plasmid#212755PurposeConstitutive expression of NUbo-E3(63)-NLS-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212749PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212748PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48) aa24-150-VSV
Plasmid#212747PurposeConstitutive expression of NUbo-E3(48)ΔU7BD-VSV in budding yeast, inactive E3(48)DepositorInsertE3(48) aa24-150
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationCue1 ΔU7BDPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-NLS-VSV
Plasmid#212745PurposeConstitutive expression of NUbo-E3(48)-NLS-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212740PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-mCherry-VSV
Plasmid#212739PurposeConsitutive expression of myc-E3(1)-CUbo-mCherry-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-mCherry-VSV and mycExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1) C885A-CUbo-VSV
Plasmid#212738PurposeConsitutive expression of myc-E3(1) C885A-CUbo-VSV in budding yeast, catalytic inactive E3(1)DepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastMutationHOIP(C885A)PromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only